pSpCas9(BB)-2A-GFP (PX458)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

2.2. Establishment of KO Cell Lines
CRISPR guide RNAs (gRNA) sequence targeting each gene were cloned into pX458 [26]. CRISPR Design (http://crispr.mit.edu/) was used to design the gRNA. A sequence with no high-scoring off-targets was selected. The selected target sequences were human ATG12- GGCTCCGGGGTGGTTGTTTC, rat ATG12- CCGGGAGGTTCCTCCGTAC, and rat amylase- AGTAATGTCAAGTTACCGATGGG. The primers used for cloning were human ATG12- 5′- CACCGGCTCCGGGGTGGTTGTTTC-3′ and 5′-AAAC GAAACAACCACCCCGGAGCC-3′, rat ATG12- 5′-CACCG CCGGGAGGTTCCTCCGTACC-3′ and 5′-AAACGGTACGGAGGAACCTCCCGGC-3′, and rat amylase- 5′-CACCGAGTAATGTCAAGTTACCGAT-3′ and 5′-AAACATCGGTAACTTGACATTACTC-3′.

MIA PaCa-2 and AR42J were transfected with pX458 with the above gRNAs inserted using Lipofectamine 2000 (Thermo Fisher). After 48 h, green fluorescent protein positive cells were isolated using a cell sorter (BD FACSARIA 3; BD Biosciences, Franklin Lakes, NJ, USA) and single clones were obtained. Clones with mutations in both alleles were identified by immunoblotting and confirmed by sequencing of genomic DNA.



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Rat - Deletion AR42J Atg12 using pSpCas9(BB)-2A-GFP (PX458) from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pSpCas9(BB)-2A-GFP (PX458) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Rat - Deletion AR42J Atg12 using pSpCas9(BB)-2A-GFP (PX458) from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.