QuikChange Lightning Site-Directed Mutagenesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- XL10-Gold cells are resistant to tetracycline and chloramphenicol. If the mutagenized plasmid contains only the tetR or camR resistance marker, an alternative strain of competent cells must be used.	- Use only the Dpn I enzyme provided; do not substitute with an enzyme from another source.

Upstream tips
- XL10-Gold cells are resistant to tetracycline and chloramphenicol. If the mutagenized plasmid contains only the tetR or camR resistance marker, an alternative strain of competent cells must be used.
Protocol tips
- Use only the Dpn I enzyme provided; do not substitute with an enzyme from another source.

Publication protocol

Plasmids and siRNA Oligos. The cDNA of HSV-1 gene ICP6 was amplified by RT-PCR from total RNA of MEF cells infected with HSV-1. For the RIP3 lentiviral expression construct, mouse RIP3 was cloned into the pCAG-MCS-IRES vector, which was a gift from
the laboratory of Yun Zhao (Soochow University). For the ICP6 retroviral expression construct, ICP6 was cloned into the PQCXIP vector. Lentiviral expression construct containing the RIP3 kinase dead mutant (RIP3 K51A) or RIP3 RHIM domain mutant (RIP3 RHIM Mut, residues from 448 to 451 are mutated to four alanine residues), and retroviral expression construct containing ICP6
RHIM domain mutant (ICP6 RHIM Mut, residues from 73 to 76 are mutated to four alanine residues) were generated using a QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene). Mouse RIP3, MLKL, RIP1, and CYLD siRNAs were synthesized by Shanghai GenePharma Co., Ltd.: RIP3 (cccgacgaugucuucugucaa),
CYLD-1 (uccauugaggauguaaauaaa), CYLD-2 (aaggguugaaccauuguuaaa), MLKL-1 (gagauccaguucaacgaua), MLKL-2 (uaccaucaaaguauucaacaa), and control siRNA (aacguacgcggaauacuucga), RIP1
(ccacuagucugacugauga), nectin-1–1 (ccggatgactcggatgatgaa),
and nectin-1–2 (caggtggaggtcaatatcaca). RNA interference was performed using INTERFERin (Polyplus).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing Site Directed Mutagenesis (SDM) Mouse - Deletion L929 ICP6 using QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies.

Manufacturer protocol

Download the product protocol from Agilent Technologies for QuikChange Lightning Site-Directed Mutagenesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing Site Directed Mutagenesis (SDM) Mouse - Deletion L929 ICP6 using QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.