GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit

CRISPR Human - Deletion DJ-1

Experiment
CRISPR Human - Deletion DJ-1
Product
GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific
Manufacturer
Thermo Fisher Scientific

Protocol tips

Protocol tips
The presence of PEG and glycerol (supplied by the Ligation Buffer and
the T4 DNA Ligase) will make the reaction mixture viscous. Be sure to mix the reaction thoroughly by pipetting up and down. Do not vortex.

Publication protocol

DJ‐1 KO HeLa cells were established using the CRISPR/Cas9 system (GeneArt CRISPR Nuclease System; Life Technologies). The vector in this kit encodes a Cas9 nuclease expression cassette and a guide RNA cloning cassette. Two types of DJ‐1 guide RNAs targeting 5′‐AGTACAGTGTAGCCGTGATG‐3′ in exon 3 and 5′‐TGCAAGCGCAAACTCGAAGC‐3′ in exon 7 were selected using the CRISPR Design web site (crispr.mit.edu) and ligated into the GeneArt CRISPR Nuclease vector (Life Technologies). HeLa cells were transfected with the obtained GeneArt CRISPR Nuclease vector and a pSilencer5.1‐H1 Retro empty vector (for puromycin selection) for 24 h. The cells were treated with 5 μg/mL puromycin for 48 h and then maintained in fresh puromycin‐free medium. Polyclonal cells were immunoblotted using an anti‐DJ‐1 antibody, and cells transfected with the GeneArt CRISPR Nuclease vector harboring the DJ‐1 guide RNA targeting 5′‐AGTACAGTGTAGCCGTGATG‐3′ were chosen. Monoclonal cell lines were generated through limiting dilutions of the aforementioned cells and were validated by immunoblotting with an anti‐DJ‐1 antibody and genomic DNA sequencing.



Full paper   Login or join for free to view the full paper.

Reviews

GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: Milena Alexeyeva Russian Federation

DNA insert using CRISPR

I would like to excise a large strand of DNA and insert a new one using CRISPR. My problem is that my strand will be a little over 1kb and I am not sure if this is going to be a limiting factor. Also, how long should the homology arms be for a region of this size?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Deletion DJ-1 using GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific.

Paper title
Unexpected mitochondrial matrix localization of Parkinson's disease-related DJ-1 mutants but not wild-type DJ-1.
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Deletion DJ-1 using GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms