lentiCRISPR v2

CRISPR Human - Deletion EGFP1

Experiment

CRISPR Human - Deletion EGFP1

Product

lentiCRISPR v2 from Addgene

Manufacturer

Addgene

Buy product Write review

Tips Publication protocol Reviews Discussion Papers Manufacturer protocol Videos

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.	There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.
Protocol tips
There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Publication protocol

Plasmids encoding sgRNA and Cas9 were purchased from Addgene, and specific sgRNA target sequences were cloned into the CRISPR v2 vector (Addgene plasmid #52961). The 20-bp target sequences of sgRNAs targeting EGFP, AAVS1, and Pten were used previously (–). The 20-bp target sequences of the indicated sgRNAs were as follows: sgEGFP-1, GGGCGAGGAGCTGTTCACCG; sgEGFP-2, GAGCTGGACGGCGACGTAAA; sgAAVS1, GGGGCCACTAGGGACAGGAT; sgNUAK2, TTGATCAGCCCTTCCGCCAG; sgPten, AGATCGTTAGCAGAAACAAA; sg53BP1, CATAATTTATCATCCACGTC. The primers used for PCR amplification of sgRNA target regions were as follows: EGFP-FP, ATGGTGAGCAAGGGCGAGGA; EGFP-RP, TTACTTGTACAGCTCGTCCA; AAVS1-FP, CCCCGTTCTCCTGTGGATTC; AAVS1-RP, ATCCTCTCTGGCTCCATCGT; NUAK2-FP, GCTTTACTGCGCGCTCTGGTACTGC; NUAK2-RP, CAGGCGCCCCGAGCTCTCCC.

Full paper Login or join for free to view the full paper.

Reviews

lentiCRISPR v2 from Addgene has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

4 years ago

Author: Milena Alexeyeva Russian Federation

DNA insert using CRISPR

I would like to excise a large strand of DNA and insert a new one using CRISPR. My problem is that my strand will be a little over 1kb and I am not sure if this is going to be a limiting factor. Also, how long should the homology arms be for a region of this size?

Comment View 2 comments

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Deletion EGFP1 using lentiCRISPR v2 from Addgene.

Paper title

CRISPR-Cas9 delivery to hard-to-transfect cells via membrane deformation

Full paper

Manufacturer protocol

Download the product protocol from Addgene for lentiCRISPR v2 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Deletion EGFP1 using lentiCRISPR v2 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

Outsource experiment