hCas9

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

CRISPR-Cas9 knockout of Hsp90α and Hsp90β genes
We utilized the guide RNA (gRNA) synthesis protocol37 to identify all 23 bp genomic sites according to the form 5′-N20NGG-3′ near the target site of human Hsp90α gene (Gene ID:3320) and human Hsp90β gene (Gene ID:3326) and selected the following genomic site: 5′-GACCCAAGACCAACCGATGGAGG-3′ (Hsp90α) or 5′-GCTGATCTCATAAATAATTTGGG-3′ (Hsp90β) for synthesizing the gRNA. Then, the 5′-20 bp of the selected target sequence, i.e. 5′-GACCCAAGACCAACCGATGG-3′ (Hsp90α) or 5′-GCTGATCTCA TAAATAATTT-3′ (Hsp90β) was incorporated (underlined) into a 455 bp DNA fragment that bears all components necessary for gRNA expression, i.e. a U6 promoter + target sequence + guide RNA scaffold + termination signal as follows: TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGACCCAAGACCAACCGATGG(Hsp90α)orGCTGATCTCATAAATAATTT (Hsp90β)GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTA. The entire DNA fragment was synthesized as guide Block (gBlock) by Integrated DNA Technologies, Inc. (Coraville, IA). For construction of the gRNA plasmid, the gBlock was amplified by PCR using primers (gRNA-block-EcoRI (F): GCGGAATTCTGTACAAAAAAGCAGGC and gRNA-block-EcoRI (R): GCGGAATTCTAATGCCAACTTTGTACA). The PCR amplicons were purified and subjected to EcoRI digestion and sub-cloned into the PiggyBac vector using the EcoRI site on the vector.

Approximately 1 × 106 MDA-MB-231 cells were plated into each well of a 6-well plate, transfected with the gRNA and hCas9 plasmids using Lipofectamine® LTX & Plus Reagent (Life Technologies, Grand Island, NY). Twenty-four hours following transfection, the medium was replaced with fresh medium containing 10 μg/ml BSD and 700 μgml G418 and incubated for an additional 4 days with daily monitoring. Drug-resistant clones were isolated following drug selection using the “ring cloning” technique and the cloned cells plated into 60-mm tissue culture dishes. The levels of Hsp90 family proteins in the cells were analysed by Western blot analysis of cell extracts.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Deletion Hsp90α using hCas9 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for hCas9 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Deletion Hsp90α using hCas9 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.