pSpCas9(BB)-2A-GFP (PX458)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Do not add antibiotics to the Plasmid Transfection Medium

Protocol tips
Do not add antibiotics to the Plasmid Transfection Medium

Publication protocol

Generation of A549 CRISPR-Cas9 genetically modified cell lines.
To inactivate the RNase L, PKR, and XRN1 genes in A549 cells (ATCC CCL-185), the CRISPR-Cas9 system was adapted from a previous method (38). Targeting sequences were designed using the Web-based tool CRISPR Design (http://crispr.mit.edu/). The following target sequences were used: RNase L, CACGTCCTCCAGCGGTAGAA; PKR, ATTCAGGACCTCCACATGAT; Xrn1, GTATCCCTGTCTCAGCGAAG. The DNA sequences were synthesized (Eurofins, Luxembourg) and separately introduced into the plasmid vector pSpCas9(BB)-2A-GFP (where GFP is green fluorescent protein) from Feng Zhang (PX458, plasmid 48138; Addgene, Cambridge, MA), which drives expression of the Streptococcus pyogenes Cas9, GFP, and the chimeric guide RNA in mammalian cells. A549 cells were transfected with the recombinant plasmids using Lipofectamine 2000 (Life Technologies). Two days after transfection, single GFP-positive cells were sorted by flow cytometry to allow single-colony formation. After 14 days, total protein was prepared from individual colonies, and the absence of proteins was confirmed by Western blotting. The RNase L and PKR CRISPR-Cas9 cell line was generated by inactivating the PKR gene in the RNase L-inactivated cells. Genome sequencing indicated the addition of an A residue (shown in italics in CACGTCCTCCAGCGGTAAGAA) within the target sequence of the RNase L gene, a T residue (shown in italics in ATTCAGGACCTCCACATTGAT) within the target sequence of the PKR gene, and a deletion of two GC residues (indicated by boldface in GTATCCCTGTCTCAGCGAAG) within the target sequence of the Xrn1 gene.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Deletion RNase L using pSpCas9(BB)-2A-GFP (PX458) from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pSpCas9(BB)-2A-GFP (PX458) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Deletion RNase L using pSpCas9(BB)-2A-GFP (PX458) from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.