pX330-U6-Chimeric_BB-CBh-hSpCas9

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	For goldengate reaction, there is a low and a high concentration mixture available for T4 ligase. For single inserts, the low concentration is just fine, but the follow-up article on golden gate cloning (PMID: 19436741) found that the high-concentration T4 was better for multiple insert cloning.

Protocol tips
For goldengate reaction, there is a low and a high concentration mixture available for T4 ligase. For single inserts, the low concentration is just fine, but the follow-up article on golden gate cloning (PMID: 19436741) found that the high-concentration T4 was better for multiple insert cloning.

Publication protocol

Plasmid construction
All viral plasmids generated for this study were produced utilizing standard recombinant DNA cloning techniques. The pAAV-pMecp2-SpCas9-spA plasmid (pX551) was a gift from Feng Zhang's laboratory (Swiech et al., 2015; Addgene #60957) and this vector served as the backbone for the inducible Cas9 vectors described in this study. The truncated PTight sequence was PCR amplified from pTRE-TIGHT-Cx43-eYFP [a gift from Robin Shaw (Smyth et al., 2010; Addgene plasmid # 31807)] and cloned into the AgeI-XbaI sites of pX551 to create the PTight-Cas9 vector. This truncated PTight sequence contained 3 Tet operators. This vector was subsequently modified by cloning into the BsmI-EcoR1 sites a new C-terminus region of Cas9 that lacked the C-term NLS and instead contained the following core PEST degron sequence (HGFPPAVAAQDDGTLPMSCAQESGMDRH; Li et al., 1998) utilizing an appropriately designed gBlock (Integrated DNA technologies) to create the PTight-Cas9PEST vector. This core PEST sequence is utilized in the destabilized eGFP variant, D1eGFP. To create the PTRE3G-Cas9PEST vector, the truncated PTRE3G sequence was PCR amplified from pLenti CMVTRE3G eGFP Neo (w821-1; A gift from Eric Campeau) and cloned into the AgeI-KpnI sites of the PTight-Cas9PEST vector. The truncated TRE3G promoter contains 2 Tet operators. The PTRE3G-Cas9PEST vector was subsequently modified by cloning in a new 5′ UTR/N-terminus region into the AgeI-BstXI sites, utilizing an appropriately designed gBlock (Integrated DNA Technologies), that lacked a Kozak sequence and the N-Terminal NLS to create the PTRE3G-ΔCas9-PEST viral vector. To create the gRNA/rtTA-GFP viral vector, the previously described AAV2 genome vector, pAAV-shRNA expression cassette vector, (Hommel et al., 2003) was systematically gutted and the appropriate sequences were subsequently cloned into it. First, the CMV-rtTA-GFP-Blastocidin S Resistance-WPRE expression cassette was removed from pMA2640 (Addgene, #25434; Alexeyev et al., 2010), and cloned into the XhoI-ClaI sites of the pAAV-shRNA vector. A short ~70 base pair 3′UTR sequence containing two polyadenylation signal sequences, which we've used previously (Holehonnur et al., 2015), was cloned into the ClaI-MluI sites. The Blastocidin S Resistance coding region was removed and the appropriate portion of GFP with a stop codon was cloned back into the BamHI-MroI sites. The gRNA expression cassette was PCR amplified from pX330 [Gift from Feng Zhang (Cong et al., 2013; Addgene, #42230)] using the following DNA primers, (gRNA RsrII FP ataCGGTCCGgagggcctatttcccatgattccttc, gRNA XhoI RP aacCTCGAGgccatttgtctgcagaattggcgcacg), and cloned into the RsrII-XhoI sites, to create the final AAV2-gRNA/rtTA-GFP viral vector. Because the BbsI sites used for cloning the gRNAs into the gRNA expression cassette were not unique to this AAV plasmid, the gRNAs were first cloned into the BbsI sites of the pX330 plasmid and then the entire gRNA expression cassette was transferred into the AAV plasmid via the RsrII-XhoI sites utilizing the above mentioned DNA primers. The DNA oligonucleotides coding for the Tet2 gRNAs compatible with the pX330 plasmid were previously described (Wang et al., 2013; Top: CACCGAAAGTGCCAACAGATATCC, Bot: AAACGGATATCTGTTGGCACTTTC). The AAV2-gRNAi-TetR viral vector was developed starting with the AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR plasmid (Addgene, #60231; Platt et al., 2014) as a backbone. The CMV promoter driving the TetR coding region was PCR amplified from pQCXIN-TetR-mCherry plasmid [a gift from Tom Misteli (Roukos et al., 2013; Addgene, # 59417)] and it was inserted into this vector via the XbaI-NheI sites. This resulted in the removal of the hSyn-Cre region. Next, an inducible gRNA expression cassette containing an HI/TO promoter was created using an appropriately designed gBlock (Integrated DNA Technologies) and it was cloned into the MluI-Xbal sites, to create the AAV2-gRNAi-TetR viral vector. Guide RNA sequences can be cloned into this vector via the SapI sites, in a similar manner as to how gRNA sequences are cloned into the AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR plasmid (Addgene, #60231; Platt et al., 2014) or the similar pX552, pAAV-U6sgRNA-hSyn-GFP-KASH-bGH vector (Addgene, # 60958). The Tet2 gRNA sequences used with this vector were (Top: ACCGAAAGTGCCAACAGATATCC, Bot: AACGGATATCTGTTGGCACTTTC). The entire HI/TO gRNAi expression cassette can be PCR amplified with the following DNA primers [H1TO gRNA FP (MluI) AGCTACGCGTAATATTTGCATGTC and H1TO gRNA RP (XbaI) ACGTTCTAGAACTAGTCCATGG]. The entire U6/TO and H1-L/TO expression cassettes containing the Tet2 gRNA were PCR amplified from appropriately designed gBlocks (Integrated DNA Technologies) and inserted into the AAV2-gRNAi-TetR viral vector via the MluI-XbaI sites. The DNA sequences for these new plasmids will be made available upon request. All gRNA viral plasmids will be made available through Addgene.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Deletion Neuro 2a TET2 using pX330-U6-Chimeric_BB-CBh-hSpCas9 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pX330-U6-Chimeric_BB-CBh-hSpCas9 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Deletion Neuro 2a TET2 using pX330-U6-Chimeric_BB-CBh-hSpCas9 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.