CpGenome Universal DNA Modification Kit

DNA methylation profiling Gene specific profiling - Ca Ski HPV-16

Experiment
DNA methylation profiling Gene specific profiling - Ca Ski HPV-16
Product
CpGenome Universal DNA Modification Kit from Millipore
Manufacturer
Millipore

Protocol tips

Protocol tips
For best results, the CT Conversion Reagent should be prepared freshly and used immediately following preparation.

Publication protocol

Bisulfite sequencing.
For mapping of methylated cytosine residues (14), DNAs were modified by a CpGenomeTm DNA modification kit (Intergen Inc.) and the reaction products were amplified with primers specific for modified HPV-16 DNA. Msp3F (genomic positions 4322 to 4348; ATTTGATATTATATTTAAGGTTGAA) and msp3R (4970 to 4946; AATAATTACAAAAACAAAATCTACA) spanned part of the L2 gene. Msp4F (7498 to 7522; TAGTTTTATGTTAGTAATTATGGTT) and msp4R (161 to 140; ACAACTCTATACATAACTATAATA) amplified a segment with the enhancer-promoter. The amplification products were directly sequenced with the same primers.

Full paper   Login or join for free to view the full paper.

Reviews

CpGenome Universal DNA Modification Kit from Millipore has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

2 years ago

Author: Jody Hancock Canada

How can I preserve leukocytes for DNA methylation profiling?

I would like to preserve leukocytes for future epigenetic analysis. How can I preserve them effectively in order to perform DNA methylation profiling at a later time?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA methylation profiling Gene specific profiling - Ca Ski HPV-16 using CpGenome Universal DNA Modification Kit from Millipore.

Paper title
CpG Methylation of Human Papillomavirus Type 16 DNA in Cervical Cancer Cell Lines and in Clinical Specimens: Genomic Hypomethylation Correlates with Carcinogenic Progression
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Millipore for CpGenome Universal DNA Modification Kit below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA methylation profiling Gene specific profiling - Ca Ski HPV-16 using CpGenome Universal DNA Modification Kit from Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms