First-Strand cDNA Synthesis Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Heat the RNA solution to 65ºC for 10 minutes, then chill on ice. Add first-strand cDNA reaction mix and incubate at 37°C for 1 hour

Protocol tips
Heat the RNA solution to 65ºC for 10 minutes, then chill on ice. Add first-strand cDNA reaction mix and incubate at 37°C for 1 hour

Publication protocol

24 h post‐sham or mild closed head injury (mCHI) treatment (n = 5 per condition), mice were killed by CO2 inhalation. Brains were rapidly harvested. The right and left cortices were immediately removed and quartered, such that the posterior (back) right cortices encompassed the impact site whereas the anterior (front) right did not. The RNA was isolated from the two right hemisphere cortical quarters (front and back) of sham and mCHI treated mice. In brief, the cortical tissue was homogenized and total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA; Puntambekar et al. 2011).

Following RNA extraction, first strand cDNA was synthesized per the conditions outlined in the cDNA synthesis kit (GE healthcare, Pittsburgh, PA, USA; Puntambekar et al. 2011). qPCR was then performed as previously described using a CFX96 Real Time PCR Detection System (Bio‐Rad Laboratories, Hercules, CA, USA). The relative number of transcripts per hypoxanthine guanine phosphoribosyl transferase (HPRT) transcripts was determined using calibration standards for each of the tested molecules. Briefly, PCR products served as standards for calibration of quantitative PCR. These standards were diluted to obtain a standard curve of 50, 5, 0.5, 0.05, 0.005 and 0.0005 pg for qPCR analysis. To minimize experimental variations from one sample to another, the copy number per sample was normalized to the expression of HPRT. It was verified that the copy number of HPRT transcripts was of the same order of magnitude in all samples being compared. Primers for HPRT are CCCTCTGGTAGATTGTCGCTTA (forward) and AGATGCTGTTACTGATAGGAAATCGA (reverse), for inducible nitric oxide (iNOS) are GGCAGCCTGTGAGACCTTTG (forward) and GCATTGGAAGTGAAGCGTTTC (reverse), for glial fibrillary acidic protein (GFAP) are CAGCCCTGGCGTCGTGATTA (forward) and AGCAAGACGTTCAGTCCTGTC (reverse), and for P2Y12 are AGGCTTTGGGAACTTATGC (forward) and GGGTGGTATTGGCTGAGGTG (reverse).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing cDNA synthesis Tissue using First-Strand cDNA Synthesis Kit from GE Healthcare Life Sciences.

Manufacturer protocol

Download the product protocol from GE Healthcare Life Sciences for First-Strand cDNA Synthesis Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing cDNA synthesis Tissue using First-Strand cDNA Synthesis Kit from GE Healthcare Life Sciences. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.