pSpCas9(BB)-2A-GFP (PX458)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	For goldengate reaction, there is a low and a high concentration mixture available for T4 ligase. For single inserts, the low concentration is just fine, but the follow-up article on golden gate cloning (PMID: 19436741) found that the high-concentration T4 was better for multiple insert cloning.

Protocol tips
For goldengate reaction, there is a low and a high concentration mixture available for T4 ligase. For single inserts, the low concentration is just fine, but the follow-up article on golden gate cloning (PMID: 19436741) found that the high-concentration T4 was better for multiple insert cloning.

Publication protocol

CRISPR/Cas9 constructs and sgRNA design.
Two pairs of sgRNAs were designed by using the ZiFit Web application (http://zifit.partners.org/) to target the amino-terminal regions of the HPV-18 E6 and E7 open reading frames (ORFs). RGNs were constructed by cloning HPV-specific sgRNAs into the px330 vector (Addgene) expressing S. pyogenes Cas9 (16). sgRNAs were also cloned into the px458 vector, an alternative version of px330 containing a gfp marker useful for flow cytometric analysis (22). RGN function was tested by generating a vector containing either HPV-18 E6- or E7-derived viral DNA targets inserted in frame between an HIV-1 rev gene fragment encoding amino acids 1 to 59 of Rev (23) and a 3′ gfp indicator gene. Following cotransfection of the reporter plasmid with a S. pyogenes Cas9/sgRNA expression construct, function was determined by detecting the specific loss of Rev and green fluorescent protein (GFP) expression by Western blotting and flow cytometry, respectively. HPV-16-specific sgRNAs targeting the HPV-16 E6 and E7 ORFs integrated into the SiHa cell line were designed and tested by using a similar approach. The following gene-specific sgRNA sequences were used and constructed, as outlined previously (16): HPV-18 E6t1 (GGCGCTTTGAGGATCCAACA), HPV-18 E6t2 (GAAGCTACCTGATCTGTGCA), HPV-18 E7t1 (GGAGCAATTAAGCGACTCAG), HPV-18 E7t2 (GAAGAAAACGATGAAATAGA), HPV-16 E6t1 (GCAACAGTTACTGCGACGTG), and HPV-16 E7t1 (GCCAGCTGGACAAGCAGAAC) (nucleotides in boldface type indicate mismatched 5′ G residues required for transcription initiation from a U6 promoter).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Repression HPV-18 E6 using pSpCas9(BB)-2A-GFP (PX458) from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pSpCas9(BB)-2A-GFP (PX458) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Repression HPV-18 E6 using pSpCas9(BB)-2A-GFP (PX458) from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.