peSpCas9(1.1)-2×sgRNA (empty, donor)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Generation of xCT-deficient U251 cells
To generate xCT knock-out U251 cells, we used the CRISPR/Cas9-mediated homology-independent knock-in system (42). sgRNAs targeting SLC7A11 sequences were cloned into the tandem sgRNA expression vector peSpCAS9(1.1)-2xsgRNA (Addgene plasmid 80768), which has a Cas9 with enhanced specificity (eSpCas9) and tandem expression cassettes of sgRNAs. The first sgRNA targets SLC7A11, and the second sgRNA targets the donor vector pDonor-tBFP-NLS-Neo (Addgene plasmid 80766). The cleavage site of pDonor-tBFP-NLS-Neo is located upstream of the cytomegalovirus promoter to enable insertion of the sequence encoding blue fluorescent protein (tBFP) fused with a triplicated nuclear localization signal (NLS). U251 cells were seeded in two 6-cm dishes (250,000 cells/dish). Twenty-four hours later, the cells were cotransfected with peSpCAS9(1.1)-2xsgRNA containing sgRNA targeting SLC7A11 and pDonor-tBFP-NLS-Neo. Two days after transfection, the cells were collected and seeded in two 10-cm dishes in medium containing 250 μg/ml G418 (Wako) to eliminate untransfected cells. Ten days after selection, colonies grown from single cells with nuclear tBFP fluorescence were isolated. These clones were expanded and screened by immunoblotting with anti-xCT antibody.

The following primers were used to clone sgRNA into peSpCAS9(1.1)-2xsgRNA: sgSLC7A11-1F, caccaccatagtagggacacacgg; sgSLC7A11-1R, aaacccgtgtgtccctactatggt; sgSLC7A11-2F, cacctgcagggaaatgttaacggg; sgSLC7A11-2R, aaaccccgttaacatttccctgca; sgSLC7A11-3F, caccccccgtgtgtccctacta; sgSLC7A11-3R, aaactagtagggacacacgggg; sgCtrl-F, cacctgagcgacaacgagatccag; and sgCtrl-R, aaacctggatctcgttgtcgctca. The control sgRNA (sgCtrl) vector used in this study contains sgRNA targeting the human scribble sequence we tried to use for another study, but this sgRNA had no effect on scribble protein expression, although cells with nuclear tBFP fluorescence were isolated. sgSLC7A11-1 and -2 were designed using the online tool CRISPOR (http://crispor.tefor.net/crispor.py)3 and Fusi/Doench scores (43). sgSLC7A11-3 was designed based on a previous report (19).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Repression SLC7A11 using peSpCas9(1.1)-2×sgRNA (empty, donor) from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for peSpCas9(1.1)-2×sgRNA (empty, donor) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Repression SLC7A11 using peSpCas9(1.1)-2×sgRNA (empty, donor) from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.