lentiGuide-Puro

CRISPR Human - Repression BIRC5

Experiment
CRISPR Human - Repression BIRC5
Product
lentiGuide-Puro from Addgene
Manufacturer
Addgene

Protocol tips

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Lentiviral vector production
The lentiviral CRISPR/Cas9 nickase-mediated BIRC5 gene editing vectors were constructed by annealing four gRNA oligonucleotide pairs and subcloning them in the BsmII site of lentiviral vector Lentiguide-puro vector (#52963, Addgene), and gRNAs were driven by human U6 promoter. Two gRNA sequences, 5’CGGGTCCCGCGATTCAAATC and 5’AGAGGTGGCGGCGGCGGCAT, were designed. CRISPRcas9 nickase was in a separate vector, LentiCas9-blast (#52962, Addgene) and driven by EF1a promoter. Lentiviral BIRC5 overexpression vector was purchased from Applied Biological Materials Inc (Richmond, Canada). Lentivirus was produced by packaging in 293FT cells, as published previously [46]. Stable cell lines were generated by transducing the SKOV3 and OVCAR3 cells with the lentiviral CRISPR/Cas9 nickase-mediated BIRC5 gene editing and lentiCas9-blast Cas9 nickase vectors and selected with 5 μg/ml puromycin or 10ug/ml blasticidin. LentiCas9-blast was used as the control vector without gRNAs.



Full paper   Login or join for free to view the full paper.

Reviews

lentiGuide-Puro from Addgene has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

5 years ago

Author: Milena Alexeyeva Russian Federation

DNA insert using CRISPR

I would like to excise a large strand of DNA and insert a new one using CRISPR. My problem is that my strand will be a little over 1kb and I am not sure if this is going to be a limiting factor. Also, how long should the homology arms be for a region of this size?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Repression BIRC5 using lentiGuide-Puro from Addgene.

Paper title
Lentiviral CRISPR/Cas9 nickase vector mediated BIRC5 editing inhibits epithelial to mesenchymal transition in ovarian cancer cells
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Addgene for lentiGuide-Puro below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Repression BIRC5 using lentiGuide-Puro from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms