lentiGuide-Puro

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Lentiviral vector production
The lentiviral CRISPR/Cas9 nickase-mediated BIRC5 gene editing vectors were constructed by annealing four gRNA oligonucleotide pairs and subcloning them in the BsmII site of lentiviral vector Lentiguide-puro vector (#52963, Addgene), and gRNAs were driven by human U6 promoter. Two gRNA sequences, 5’CGGGTCCCGCGATTCAAATC and 5’AGAGGTGGCGGCGGCGGCAT, were designed. CRISPRcas9 nickase was in a separate vector, LentiCas9-blast (#52962, Addgene) and driven by EF1a promoter. Lentiviral BIRC5 overexpression vector was purchased from Applied Biological Materials Inc (Richmond, Canada). Lentivirus was produced by packaging in 293FT cells, as published previously [46]. Stable cell lines were generated by transducing the SKOV3 and OVCAR3 cells with the lentiviral CRISPR/Cas9 nickase-mediated BIRC5 gene editing and lentiCas9-blast Cas9 nickase vectors and selected with 5 μg/ml puromycin or 10ug/ml blasticidin. LentiCas9-blast was used as the control vector without gRNAs.



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Repression BIRC5 using lentiGuide-Puro from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for lentiGuide-Puro below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Repression BIRC5 using lentiGuide-Puro from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.