Edit-R CRISPR-Cas9 Nuclease Expression Plasmid

Protocol tips

Upstream tips	Protocol tips	Downstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Generation of knockouts using the CRISPR- system.
() mutant cell lines CHO-23A1 and CHO-93A5 were generated using the Edit-R CRISPR- gene engineering system (Dharmacon GE Healthcare) according to the manufacturer’s instructions. In short, CHO-K1 cells were cotransfected with a expression vector containing a blasticidin resistance marker (pHCSVBlast-Cas9, catalog number U-001000-120), -activating CRISPR RNA (tracrRNA) (catalog number U-002000-120), and CRISPR RNA (crRNA) specific for CHO (crRNA-107962; 5′ GAGGCACUAAUGGGCGCUGCGUUUUAGAGCUAUGCUGUUUUG 3′). The target sequence (GAGGCACTAATGGGCGCTGCTGG, target identifier (ID) 791342), found in exon 1, was determined using CRISPy, a web-based target-finding tool for CHO-K1 cells (). Two days after transfection, cells were selected by incubation with 10-μg/ml blasticidin S (Thermo Fisher Scientific) for 5 days, and cells were then seeded in 96-well plates to obtain single-cell clones. The clonal lines obtained were screened for heparan sulfate expression by flow cytometry using the anti-heparan sulfate single-chain antibody HS4C3 () as described below (see “Flow cytometry”).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Repression XylT2 using Edit-R CRISPR-Cas9 Nuclease Expression Plasmid from Dharmacon.

Manufacturer protocol

Download the product protocol from Dharmacon for Edit-R CRISPR-Cas9 Nuclease Expression Plasmid below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Repression XylT2 using Edit-R CRISPR-Cas9 Nuclease Expression Plasmid from Dharmacon. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.