Edit-R CRISPR-Cas9 Nuclease Expression Plasmid

CRISPR Mouse - Repression XylT2

Experiment
CRISPR Mouse - Repression XylT2
Product
Edit-R CRISPR-Cas9 Nuclease Expression Plasmid from Dharmacon
Manufacturer
Dharmacon

Protocol tips

Upstream tips
To access a plasmid, keep the plate on dry ice to prevent thawing. Using a sterile pipette tip (20uL or 200uL one), puncture the seal above an individual well and spread a portion of the glycerol stock onto an agar plate.

Publication protocol

Generation of knockouts using the CRISPR- system.
() mutant cell lines CHO-23A1 and CHO-93A5 were generated using the Edit-R CRISPR- gene engineering system (Dharmacon GE Healthcare) according to the manufacturer’s instructions. In short, CHO-K1 cells were cotransfected with a expression vector containing a blasticidin resistance marker (pHCSVBlast-Cas9, catalog number U-001000-120), -activating CRISPR RNA (tracrRNA) (catalog number U-002000-120), and CRISPR RNA (crRNA) specific for CHO (crRNA-107962; 5′ GAGGCACUAAUGGGCGCUGCGUUUUAGAGCUAUGCUGUUUUG 3′). The target sequence (GAGGCACTAATGGGCGCTGCTGG, target identifier (ID) 791342), found in exon 1, was determined using CRISPy, a web-based target-finding tool for CHO-K1 cells (). Two days after transfection, cells were selected by incubation with 10-μg/ml blasticidin S (Thermo Fisher Scientific) for 5 days, and cells were then seeded in 96-well plates to obtain single-cell clones. The clonal lines obtained were screened for heparan sulfate expression by flow cytometry using the anti-heparan sulfate single-chain antibody HS4C3 () as described below (see “Flow cytometry”).

Full paper   Login or join for free to view the full paper.

Reviews

Edit-R CRISPR-Cas9 Nuclease Expression Plasmid from Dharmacon has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

2 years ago

Author: Mario Udinese Italy

Floxing mice with CRISPR

Hi everyone! I am planning on floxing mice with CRISPR but I am having trouble deciding which region to target. Do you have any tips on choosing?

Discussion

2 years ago

Author: Ben Saar Israel

How to choose a region to target for CRISPR

Hi everyone! I am planning on floxing mice with CRISPR but I am having trouble deciding which region to target. Do you have any tips on choosing?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Mouse - Repression XylT2 using Edit-R CRISPR-Cas9 Nuclease Expression Plasmid from Dharmacon.

Paper title
Whole-Genome Sequencing of Invasion-Resistant Cells Identifies Laminin α2 as a Host Factor for Bacterial Invasion
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Dharmacon for Edit-R CRISPR-Cas9 Nuclease Expression Plasmid below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Mouse - Repression XylT2 using Edit-R CRISPR-Cas9 Nuclease Expression Plasmid from Dharmacon. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms