pAC154-dual-dCas9VP160-sgExpression

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	For goldengate reaction, there is a low and a high concentration mixture available for T4 ligase. For single inserts, the low concentration is just fine, but the follow-up article on golden gate cloning (PMID: 19436741) found that the high-concentration T4 was better for multiple insert cloning.

Protocol tips
For goldengate reaction, there is a low and a high concentration mixture available for T4 ligase. For single inserts, the low concentration is just fine, but the follow-up article on golden gate cloning (PMID: 19436741) found that the high-concentration T4 was better for multiple insert cloning.

Publication protocol

Plasmid construction. Generic sgRNA-expressing plasmids, pcDNA.H1sgRNA and pcDNA.H1sgRNA (SAM), were constructed using full-length gBlocks (IDT, Coralville, IA) comprising an H1 promoter, chimeric guide RNA backbone, and sgRNA cloning site (Supplementary Data). The gBlocks were cloned by Gibson Assembly into the BglII/BbsI site of pcDNA3.1(+) (Thermo Fisher Scientific, MA) and contain BsmBI sites allowing for facile cloning of sgRNAs by oligo annealing as described previously (Supplementary Data).19 To generate subtype-specific LTR reporter vectors, full-length 3′ LTR promoters from HIV subtype B (Genbank accession: AF324493), subtype A (AB253429), and subtype C (AF067154) were amplified from LGIT plasmid templates49 and cloned by Gibson Assembly into the PciI/AgeI digested pmCherry-C1 (Clontech, CA) using the following primers: LTR_F 5′-TGGCCTTTTGCTGGCCTTTTGCTCAACTAGTGACTTACAAGGCAGCTGTAGATC-3′ and LTR_R 5′- CTCACCATGGTGGCGACCGGTAGCGACCACAGGAAACAGCTATGACCATGATTA-3′. The dCas9-activator vectors include: pAC154-dual-dCas9VP160-sgExpression (Addgene plasmid #48240),29 pHAGE EF1α dCas9-VP64 (Addgene plasmid #50918),35 SP-dCas9-VPR (Addgene plasmid #63798),30 and lenti-MS2-P65-HSF1_Hygro (Addgene plasmid #61426).33 The following reagent was obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pNL4-3.Luc.R–.E– from Dr Nathaniel Landau.50,51

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Activation HIV-1 5′ LTR using pAC154-dual-dCas9VP160-sgExpression from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for pAC154-dual-dCas9VP160-sgExpression below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Activation HIV-1 5′ LTR using pAC154-dual-dCas9VP160-sgExpression from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.