lentiCRISPR v2
CRISPR Human - Activation α-synuclein
Protocol tips
| Protocol tips |
|---|
| There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success. |
Publication protocol
4.3. PlasmidsLentiCRISPR-v2 construct was purchased from Addgene. Oligonucleotides were synthesized by Cosmo Genetech. LentiCRISPR-gRNA to human telomere repeats was constructed by ligating gRNA oligonucleotides into BsmBI restriction site of pLenti-CRISPR-v2 plasmid (Addgene). The gRNA targeting sequence for telomere sequence was (F: CACCGTAGGGTTAGGGTTAGGGTTA; R: AAACTAACCCTAACCCTAACCCTAC). The HA-α-synuclein construct was described previously [38].
Full paper Login or join for free to view the full paper.
Reviews
lentiCRISPR v2 from Addgene has not yet been reviewed for this experiment
We'd love it if you would be the first to write a review!
Discussion
Discussion
4 years ago
Author:
Milena Alexeyeva
DNA insert using CRISPR
I would like to excise a large strand of DNA and insert a new one using CRISPR. My problem is that my strand will be a little over 1kb and I am not sure if this is going to be a limiting factor. Also, how long should the homology arms be for a region of this size?
Papers
Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Activation α-synuclein using lentiCRISPR v2 from Addgene.
Manufacturer protocol
Download the product protocol from Addgene for lentiCRISPR v2 below.
Download manufacturer protocol
Videos
Check out videos that might be relevant for performing CRISPR Human - Activation α-synuclein using lentiCRISPR v2 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.
We haven't found any additional videos for this experiment / product combination yet.
Outsource your experiment
Fill out your contact details and receive price quotes in your Inbox
Outsource experiment