GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit

CRISPR Human - Activation CD20

Experiment
CRISPR Human - Activation CD20
Product
GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific
Manufacturer
Thermo Fisher Scientific

Protocol tips

Protocol tips
The presence of PEG and glycerol (supplied by the Ligation Buffer and
the T4 DNA Ligase) will make the reaction mixture viscous. Be sure to mix the reaction thoroughly by pipetting up and down. Do not vortex.

Publication protocol

2.4. Establishment of ERBB2+ and ERBB2− Target Cells
The gene encoding ERBB2 was invalidated in HEK293 cells using CRISPR/Cas9 genome editing. Briefly, a guide RNA sequence (TCATCGCTCACAACCAAGTG) was cloned into the nuclease vector GeneArt CRISPR (ThermoFisher Scientific, France) to guide the Cas9 double-stranded DNA endonuclease to a specific site within exon 6 of the ERBB2 gene to isolate ERBB2− HEK293 cells. HEK293− cells were then transfected with an ERBB2 expression vector (InvivoGen, San Diego, CA) using the FuGENE HD transfection reagent (Promega, Madison, WI). Positive clones were enriched using fluorescence-activated cell sorting and a FITC-labelled anti-ERBB2 monoclonal antibody (Abcam, Cambridge, UK). Stable clones were isolated and characterized for ADCC activity in the presence of the iLite effector cells and Herceptin™ (Roche, France) giving rise to the ERBB2+ HEK293 target cell line.

Full paper   Login or join for free to view the full paper.

Reviews

GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: Milena Alexeyeva Russian Federation

DNA insert using CRISPR

I would like to excise a large strand of DNA and insert a new one using CRISPR. My problem is that my strand will be a little over 1kb and I am not sure if this is going to be a limiting factor. Also, how long should the homology arms be for a region of this size?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Activation CD20 using GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific.

Paper title
A Novel System for the Quantification of the ADCC Activity of Therapeutic Antibodies
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Activation CD20 using GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms