DNeasy Blood & Tissue Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
		- Include RNAse treatment for 15-20 min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C - Use prewarmed TE buffer to elute the DNA

Downstream tips
- Include RNAse treatment for 15-20 min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C - Use prewarmed TE buffer to elute the DNA

Publication protocol

DNA Methylation assay
DNA was isolated from cortical rat astrocytes using the DNeasy Blood & Tissue Kit, fragmented by sonication, and subjected to MethylMiner™ methylated DNA kit enrichment according to the manufacturer's protocol to precipitate methylated DNA and input samples were collected before the precipitation. The precipitated, methylated DNA was further purified using the QIAquick PCR Purification Kit. DNA methylation levels in the promoter region of tPA were determined by quantitative PCR using the Stratagene MxPro-Mx3000P Systems and SYBR green assay. Tissue-PA primers include forward, AGCTTAGAGCCGCACATCCTTACA, and reverse, CTTGGCTTGACGCCAGCTTGATTA. Data were calculated as 2−ΔΔCT (ΔCT= target gene CT – input CT) and expressed as fold change over control as previously described (Livak and Schmittgen 2001).



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA isolation / purification Cells - Primary cells Rat astrocytes using DNeasy Blood & Tissue Kit from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for DNeasy Blood & Tissue Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA isolation / purification Cells - Primary cells Rat astrocytes using DNeasy Blood & Tissue Kit from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.