Superscript reverse tran-scriptase II (SS RT II) system

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Heat Oligo mixture to 65°C for 5 min and quick chill on ice and later add reaction components. Mix and incubate at 42°C for 2 min. Add 1 μL (200 units) of SuperScript™ II RT and mix by pipetting gently up and down. Incubate at 42°C for 50 min. Inactivate the reaction by heating at 70°C for 15 min.

Protocol tips
Heat Oligo mixture to 65°C for 5 min and quick chill on ice and later add reaction components. Mix and incubate at 42°C for 2 min. Add 1 μL (200 units) of SuperScript™ II RT and mix by pipetting gently up and down. Incubate at 42°C for 50 min. Inactivate the reaction by heating at 70°C for 15 min.

Publication protocol

The induction of stresses was verified by quantification of the expression levels of stress‐regulated genes: HSP12, GPD1, PDR12, and EXO1. Description of the genes is presented in Table 1. We have used 5S rRNA gene (RDN5) as a reference with constant expression. Reverse transcription reactions were carried out using a Superscript reverse transcriptase II (SS RT II) system (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). Primers were used at a final concentration of 100 μm. Sequences of the primers are as follows: HSP12 Fwd 5′‐TCTTCCAAGGTGTCCACGAC‐3′; HSP12 Rev 5′‐TCGTTCAACTTGGACTTGGC‐3′; GPD1 Fwd 5′‐GGTTGGAAACATGTGGCTCT‐3′; GPD1 Rev 5′‐GGCAGGTTCTTCATTGGGTA‐3′; PDR12 Fwd 5′‐GTCGTTGAATCTGGTGAAATG‐3′; PDR12 Rev 5′‐AGACATCATTTCGCTTTGGTC‐3′; EXO1 Fwd 5′‐TGGTGATGCCATTCCAGTTA‐3′; EXO1 Rev 5′‐AACGGAGCCACTATGTACCG‐3′; RDN5 Fwd 5′‐AGATTGCAGCACCTGAGTTT3′; RDN5 Rev 5′‐GGTTGCGGCCATATCTACCA‐3′. Quantitative PCRs (25 μL) were performed on aliquots of a reverse transcription reaction using Eva green system (Solis Biodyne, Tartu, Estonia). Datasets were collected on an Agilent real‐time PCR system and analyzed using maxpro version 3.1 software (Honeywell, Louisville, KY, USA). The cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles consisting of 45 s at 94 °C, 30 s at 57 °C, and 20 s at 72 °C. Fluorescence signal data were collected during the 72 °C phase of each cycle. Melt curves from 56 °C to 95 °C (in 0.5 °C increments, measuring fluorescence at each temperature) were collected for all samples following the last cycle and showed the presence of only one product in each reaction. The standard curves were used to derive the copy number of each transcript in each RNA sample, which was determined in triplicate. Statistical analysis was performed using GraphPad Prism v5.01. Data were collected as triplicate from at least three independent experiments. The results were expressed as mean ± standard deviation (SD). Differences between the means of treatments were evaluated using one‐way analysis of variance (ANOVA) followed by Tukey's test.



Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing cDNA synthesis Yeast using Superscript reverse tran-scriptase II (SS RT II) system from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Superscript reverse tran-scriptase II (SS RT II) system below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing cDNA synthesis Yeast using Superscript reverse tran-scriptase II (SS RT II) system from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.