HuR siRNA

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	siRNA sequence: 5′AACACGCTGAACGGCTTGAGG siRNA concentratin:Mix 20-mM stock duplex siHuR with 300 μl of Opti-MEM medium. Incubate for 20 min at room temperature and gently add to cells. Incubate cells for 48 h at 37°C

Protocol tips
siRNA sequence: 5′AACACGCTGAACGGCTTGAGG siRNA concentratin:Mix 20-mM stock duplex siHuR with 300 μl of Opti-MEM medium. Incubate for 20 min at room temperature and gently add to cells. Incubate cells for 48 h at 37°C

Publication protocol

The silencing RNA duplexes that were designed to specifically inhibit HuR mRNA were synthesized and transfected into cells as described previously (47). The sequence of small interfering RNA (siRNA) that specifically targets HuR mRNA (siHuR) was AACACGCTGAACGGCTTGAGG; while the sequence of control siRNA (C-siRNA) was AAGTGTAGTAGATCACCAGGC. The siRNA that was designed to specifically inhibit Chk2 mRNA (siChk2) was GAACCUGAGGAGCCUACCC, to inhibit c-Myc mRna (sic-Myc) was (CGAGCUAAAACGGAGCUUU), whereas the sequences of its C-siRNA were CAGCTGGTCTTTGACTACACCAACA and GGCUACGUCCAGGAGCGCA. For each 60-mm cell culture dish, 15 μl of the 20-mM stock duplex siHuR, siChk2, sic-Myc, or C-siRNA was mixed with 300 μl of Opti-MEM medium (Invitrogen). This mixture was gently added to a solution containing 15 μl of Lipofectamine 2000 in 300 μl of Opti-MEM. The solution was incubated for 20 min at room temperature and gently overlaid onto monolayers of cells in 3 ml of medium, and cells were harvested for various assays after 48 h later.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Rat - IEC-6 HuR Lipid using HuR siRNA from Santa Cruz Biotechnology.

Manufacturer protocol

Download the product protocol from Santa Cruz Biotechnology for HuR siRNA below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Rat - IEC-6 HuR Lipid using HuR siRNA from Santa Cruz Biotechnology. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.