NM_001350

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Seed 2.5 × 10^5	Daxx siRNA: 5′-GGAGUUGGAUCUCUCAGAA Add diluted siRNA to diluted Lipofectamine® RNAiMAX Reagent (1:1 ratio).  Incubate for 5 minutes at room temperature and add to cells.  Incubate cells for 1day at 37°C and later transfect by electroporation with 2 μg of circularized wt HPV18 or wt HPV11 genome and incubate for another 48 h

Upstream tips
Seed 2.5 × 10^5
Protocol tips
Daxx siRNA: 5′-GGAGUUGGAUCUCUCAGAA Add diluted siRNA to diluted Lipofectamine® RNAiMAX Reagent (1:1 ratio).  Incubate for 5 minutes at room temperature and add to cells.  Incubate cells for 1day at 37°C and later transfect by electroporation with 2 μg of circularized wt HPV18 or wt HPV11 genome and incubate for another 48 h

Publication protocol

siRNAs
The siRNA target sequence for human Daxx (5′-GGAGUUGGAUCUCUCAGAA) has been published previously [37]. As a control siRNA (siCtr), non-specific siRNA (5’ CCCUGUCAGUAUUGAUAGAAA) was used. Both siRNAs were purchased from Sigma-Aldrich.

Cell lines and transfections
U2OS cells obtained from the American Type Culture Collection (ATCC) (number HTB-96) were cultured in Iscove’s modified Dulbecco’s medium supplemented with 10 % of fetal calf serum. The transfections were carried out either by electroporation as described in [38], applying 180 V or by lipofection using LipofectamineTM RNAiMAX as a transfection reagent according to manufacturer’s protocol (Invitrogen).

mRNA analysis
2.5 × 105 of U2OS cells were seeded onto 60 mm dishes the day before transfection with 200 pmol of siDaxx and siCtr siRNA duplexes by LipofectamineTM RNAiMAX. U2OS cells were counted 24 h post-transfection and an even count of cells was transfected by electroporation with 2 μg of circularized wt HPV18 or wt HPV11 genome and incubated for another 48 h. RNA was isolated using TRIZol® reagent (Invitrogen) according to the directions of the manufacturer. 5 μg of DNase I-treated total cellular RNA was used in reverse transcription reactions with oligo(dT)18 primers using First Strand cDNA Synthesis Kit (Fermentas). The reaction products were treated with RNase H (Fermentas). 1/40th of the cDNA was used for analysis by qPCR.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Human - U2OS DAXX using NM_001350 from Sigma-Aldrich.

Manufacturer protocol

Download the product protocol from Sigma-Aldrich for NM_001350 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Human - U2OS DAXX using NM_001350 from Sigma-Aldrich. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.