Mm_Hdac5_2 FlexiTube siRNA

siRNA / miRNA gene silencing Mouse - RAW264.7 HDAC5

Experiment
siRNA / miRNA gene silencing Mouse - RAW264.7 HDAC5
Product
Mm_Hdac5_2 FlexiTube siRNA from Qiagen
Manufacturer
Qiagen

Protocol tips

Protocol tips
MmHDAC5_2
S-GCCUCGGAACCCAACUUAATT
AS UUAAGUUGGGUUCCGAGGCCG
MmHDAC5_5
S-GGGCAAGAUCCUUACCAAATT
AS-UUUGGUAAGGAUCUUGCCCAG
HsHDAC5_1
SACGACACGUUCAUGCUAAATT
AS-UUUAGCAUGAACGUGUCGUAG
HsHDAC5_4
S-CGGGUUUGAUGCUGUUGAATT
AS-UUCAACAGCAUCAAACCCGGC

siRNA concentration-120 pmol

Publication protocol

Lipopolysaccharide-free plasmid DNA (6 μg) and siRNA (120 pmol; Qiagen, Hilden, Germany) was transferred by electroporation as described previously 22. RAW264.7 cells received 600 V for 100 μsec. followed by 100 V for 10 msec.; U937 cells 400 V for 400 μsec. 22. For HDAC5 over-expression RAW264.7 cells were transfected with a pCMX-based vector encoding for HA-tagged mouse HDAC5 (pHDAC5; 8267 bp) kindly provided by Ronald Evans (Salk Institute, San Diego, CA, USA) 23. To determine NF-κB activation, RAW264.7 cells were transfected with an NF-κB reporter plasmid containing a single copy of an NF-κB response element linked to a luciferase sequence (pGL4.10; 4242 bp; Clontech, Mountain View, CA, USA). In RAW264.7 cells HDAC5 expression was knocked down by transfecting HDAC5-specific (siHDAC5) or control siRNA (siCtrl; Table​Table11).

Full paper   Login or join for free to view the full paper.

Reviews

Mm_Hdac5_2 FlexiTube siRNA from Qiagen has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Mouse - RAW264.7 HDAC5 using Mm_Hdac5_2 FlexiTube siRNA from Qiagen.

Paper title
Histone deacetylase 5 regulates the inflammatory response of macrophages
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Qiagen for Mm_Hdac5_2 FlexiTube siRNA below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Mouse - RAW264.7 HDAC5 using Mm_Hdac5_2 FlexiTube siRNA from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Become shareholder Discussions About us Contact Privacy Terms