Slc1a2

siRNA / miRNA gene silencing Rat - Glial cells GLT-1

Experiment

siRNA / miRNA gene silencing Rat - Glial cells GLT-1

Product

Slc1a2 from Thermo Fisher Scientific

Manufacturer

Thermo Fisher Scientific

Buy product Write review

Tips Publication protocol Reviews Discussion Papers Manufacturer protocol Videos

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	GLT-1 (#1: UAACUUCAUGACAAUCUCGTT, #2:UCGUGGACAUGUAAUAUACAA) Seed 3 x 10^5 cells/well in a 12 well plate. Transfect with 1 μg siRNA in a media containing 5mM glutamate and incubate at 37°C with 5% CO2 overnight. For 7 days knockdown experiment, transfect cells on day 0 and day 3.

Protocol tips
GLT-1 (#1: UAACUUCAUGACAAUCUCGTT, #2:UCGUGGACAUGUAAUAUACAA) Seed 3 x 10^5 cells/well in a 12 well plate. Transfect with 1 μg siRNA in a media containing 5mM glutamate and incubate at 37°C with 5% CO2 overnight. For 7 days knockdown experiment, transfect cells on day 0 and day 3.

Publication protocol

We haven't found the publication's protocol yet.

Reviews

Slc1a2 from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Start your discussion

Share your thoughts or question with experts in your field

Start a discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Rat - Glial cells GLT-1 using Slc1a2 from Thermo Fisher Scientific.

View full paper Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Slc1a2 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Rat - Glial cells GLT-1 using Slc1a2 from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

Outsource experiment