lentiCRISPR v2

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Protocol tips
There is no need to perform a negative control golden-gate reaction (without insert) as it will always contain colonies so not a good indicator of cloning success.

Publication protocol

Single guide RNA design and lentiviral vector production
Multiple sgRNAs for each HBV DNA target were screened using a dual luciferase indicator assay, essentially as described previously (Kennedy et al., 2014). Briefly, Spy Cas9/sgRNA coexpression constructs based upon pX330 (Cong et al., 2013) were co-transfected into 293T cells at an 8:1 ratio relative to an indicator plasmid expressing a fusion protein consisting of an amino-terminal HIV-1 Rev derived epitope tag, a central target region derived from an HBV open reading frame and lastly a carboxy-terminal firefly luciferase (FLuc) indicator gene. A Renilla luciferase expression plasmid was also co-transfected as an internal control. Transfections were analyzed at 72 h post-transfection by Promega dual luciferase assay and Western blot for the expression of the encoded Rev-target-Fluc fusion protein to confirm the specific knockdown of the DNA target. The HBV DNA targets for the sgRNAs are depicted in Fig. 1A. These candidate sgRNAs were shuttled into the LentiCRISPR lentiviral expression vector (Shalem et al., 2014), which was produced at high titer in 293T cells by co-transfection, as previously described (Kennedy et al., 2014).

HBV strain AYW targets for the sgRNAs used in this work were as follows: HBV RT (GTTCAGTTATATGGATGATG), HBV surface antigen (Ag) (GCCTGTCCTCCAACTTGTCC), HBV core protein (GTACCGCCTCAGCTCTGTAT), and nonspecific control (N.S.) (GAAATCCTGCAGAAAGACCT). The initial G required for efficient RNA polymerase III transcription from the U6 promoter is underlined and is not complementary to the DNA target.

To assess the mutagenic spectrum generated by Spy Cas9/sgRNA cleavage, primers bearing unique restriction sites were designed to anneal to HBV sequences flanking the predicted Cas9 cleavage site in the RT gene. Total HBV genomic DNA was extracted from HepAD38 cells following transduction with the Cas9/sgRNA combination specific for the HBV RT gene described above, PCR amplified, cloned into pcDNA3 (Invitrogen), and Sanger sequenced. The recovered sequences were then aligned to the wild-type HBV strain AYW genome.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing CRISPR Human - Repression HBV RT using lentiCRISPR v2 from Addgene.

Manufacturer protocol

Download the product protocol from Addgene for lentiCRISPR v2 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing CRISPR Human - Repression HBV RT using lentiCRISPR v2 from Addgene. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.