RNAsimple Total RNA Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- To wipe off RNase, the glassware can be roasted at 150℃ for 4 hours, while plastic can be dipped in 0.5 M NaOH for 10min, washed by RNase-Free ddH2O thoroughly, and sterilized

Upstream tips
- To wipe off RNase, the glassware can be roasted at 150℃ for 4 hours, while plastic can be dipped in 0.5 M NaOH for 10min, washed by RNase-Free ddH2O thoroughly, and sterilized

Publication protocol

Viral RNA was extracted from the infected cells using an RNA Kit (Tiangen, Beijing, China). cDNA was prepared from total RNA using AMV reverse transcriptase (Thermo Scientific, Rockford, IL, USA) with Oligo(dT) as primer. Briefly, 20 µL reaction mixtures were incubated for 60 min at 42°C and 10 min at 72°C in succession, and then maintained at 4°. PCR was performed with 1 µL of reverse transcribed product, 12.5 µL of HotStart Taq MasterMix (Tiangen) and 1 µL of each primer (71S: 5′‐GCAGCCCAAAAGAACTTCAC‐3′; 71A: 5′‐ATTTCAGCAGCTTGGAGTGC‐3′) in 25 µL of reaction mixture. The reactions were performed at one cycle of 95°C for 5 min, followed by 32 cycles of 95°C for 30 s and 52°C for 30 s and another 72°C for 30 s for extension. Three independent experiments were conducted for each sample. PCR products were visualized by agarose gel electrophoresis.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized MA-104 using RNAsimple Total RNA Kit from Tiangen.

Manufacturer protocol

Download the product protocol from Tiangen for RNAsimple Total RNA Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized MA-104 using RNAsimple Total RNA Kit from Tiangen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.