SV Total RNA Isolation System

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	For better lysis, pipet the RNA Lysis Buffer over the bottom of the well.

Protocol tips
For better lysis, pipet the RNA Lysis Buffer over the bottom of the well.

Publication protocol

Total RNA was extracted using the SV total RNA isolation system (Promega) in accordance with the manufacturer’s instructions. Equal amounts of RNA (500 ng) were used to synthesize the first-strand cDNA using the reverse transcriptase system and then PCR. Primers used for PCR were 5′ TCAGTGCAATTGGTGGAAAA 3′ (forward) and 5′ ACCTTGAGCGGAAACCAGTA 3′ (reverse) for CerS1, 5′ CCCACCTTGGAGCATTTCTA 3′ (forward) and 5′ TCGGGTGATGATGAAGACAA 3′ (reverse) for CerS2, 5′ GATT­TTGGCTTCCTCCAACA 3′ (forward) and 5′ GGGGTAGCCATTCCATACCT 3′ (reverse) for CerS3, 5′ TCCTACAGCTCCAACCTGCT 3′ (forward) and 5′ CTGGGCAATGGAGTCGTAGT 3′ (reverse) for CerS4, 5′ GTTCTG­GGACATCCGACAGT 3′ (forward) and 5′ TGAGCTGCTTTCCACATCAC 3′ (reverse) for CerS5, 5′ TAGCCAAACCATGTGCCATA 3′ (forward) and 5′ TGCCTTGTATTCCACAACCA 3′ (reverse) for CerS6, and 5′ ACCACAGTCCATGCCATCAC 3′ (forward), and 5′ ATGTCGTTGTC­CCA­CCACCT 3′ (reverse) for GAPDH. RT-PCR products were resolved on 2% agarose gels.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized MDCK using SV Total RNA Isolation System from Promega.

Manufacturer protocol

Download the product protocol from Promega for SV Total RNA Isolation System below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized MDCK using SV Total RNA Isolation System from Promega. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.