TRIzol Reagent

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Protocol tips
- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Publication protocol

Total RNA was isolated with Trizol (Life Technologies) according to manufacturer’s instructions and then treated with DNase before cDNA synthesis (iScript TM cDNA synthesis kit, Bio-Rad, Hercules, CA, USA). Quantitative real time PCR was performed with the SYBR Green PCR Master mix kit (Bio-Rad) using the following primers: Human survivin F 5’-AGCCCTTTCAAGGACCAC-3’, R 5’-GGATCTTCATGAGGTAGTCAGTC-3’; BCR-ABL F 5’- GAGTCTCCGGGGCTCTATGG, R 5’- GCCGCTGAAGGGCTTTTGAA, human GusB F 5’- CGTCCCACCTAGAATCTGCT, R 5’- TTGCTCACAAAGGTCACAGG, human GAPDH F 5’-GGTGCTGAGTATGTCGTGGA, R 5’-ACAGTCTTCTGGGTGGCAGT. All results were normalized to the housekeeping gene GAPDH or Gus-B and expression was compared to control treated cells. Quantitation of gene expression was based on the cycle threshold (Ct) value for each sample. Delta Ct was calculated as (gene of interest Ct)-(housekeeping gene Ct). The relative quantity of mRNA expression was calculated by delta-delta Ct calculation as (treated sample delta Ct)-(control sample delta Ct). All experiments included negative controls consisting of no cDNA for each primer pair. Data represent the mean of at least two independent experiments (± S. D.).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized K-562 using TRIzol Reagent from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for TRIzol Reagent below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized K-562 using TRIzol Reagent from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.