TRIzol Reagent

RNA isolation / purification Cells - immortalized K-562

Experiment
RNA isolation / purification Cells - immortalized K-562
Product
TRIzol Reagent from Thermo Fisher Scientific
Manufacturer
Thermo Fisher Scientific

Protocol tips

Protocol tips
- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Publication protocol

Total RNA was isolated with Trizol (Life Technologies) according to manufacturer’s instructions and then treated with DNase before cDNA synthesis (iScript TM cDNA synthesis kit, Bio-Rad, Hercules, CA, USA). Quantitative real time PCR was performed with the SYBR Green PCR Master mix kit (Bio-Rad) using the following primers: Human survivin F 5’-AGCCCTTTCAAGGACCAC-3’, R 5’-GGATCTTCATGAGGTAGTCAGTC-3’; BCR-ABL F 5’- GAGTCTCCGGGGCTCTATGG, R 5’- GCCGCTGAAGGGCTTTTGAA, human GusB F 5’- CGTCCCACCTAGAATCTGCT, R 5’- TTGCTCACAAAGGTCACAGG, human GAPDH F 5’-GGTGCTGAGTATGTCGTGGA, R 5’-ACAGTCTTCTGGGTGGCAGT. All results were normalized to the housekeeping gene GAPDH or Gus-B and expression was compared to control treated cells. Quantitation of gene expression was based on the cycle threshold (Ct) value for each sample. Delta Ct was calculated as (gene of interest Ct)-(housekeeping gene Ct). The relative quantity of mRNA expression was calculated by delta-delta Ct calculation as (treated sample delta Ct)-(control sample delta Ct). All experiments included negative controls consisting of no cDNA for each primer pair. Data represent the mean of at least two independent experiments (± S. D.).

Full paper   Login or join for free to view the full paper.

Reviews

TRIzol Reagent from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: Switzerland

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized K-562 using TRIzol Reagent from Thermo Fisher Scientific.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for TRIzol Reagent below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized K-562 using TRIzol Reagent from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms