TriPure Isolation Reagent

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- Do not wash cells before adding reagent (suspension cells).	- For low contamination rate carefully remove the upper aqueous phase. - Adding too little reagent can lead to contamination with DNA.

Upstream tips
- Do not wash cells before adding reagent (suspension cells).
Protocol tips
- For low contamination rate carefully remove the upper aqueous phase. - Adding too little reagent can lead to contamination with DNA.

Publication protocol

Isolation of total RNA, reverse transcription into cDNA and Real-time PCR reactions were performed as published before, using CFX Real-time PCR System (Bio-Rad Laboratories Inc., CA). The sequences of VDR, CYP24A1 and GAPDH primers and reaction conditions were described previously. The RARA, RARB and RARG primers were obtained from RealTimePrimers.com (Real Time Primers, LLC, PA). The primers for VDR variants were: forward for VDR1a: 5′GCGGAACAGCTTGTCCACCC, for VDR1d: 5′GCTCAGAACTGCTGGAGTGG, for VDR1 g: 5′TTGCTCATCCAGCTTCCCAGAC, and reverse for all variants was: 5′GAAGTGCTGGCCGCCATTG. Quantification of gene expression was analyzed with either the ΔCq or ΔΔCq method using GAPDH as the endogenous control. Primers efficiencies were measured in all cell lines using a Real-time PCR reaction based on the slope of the standard curve. The results were normalized to primer efficiencies to compare gene expression in different cell lines. Real-time PCR assays were performed at least in triplicate.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized KG-1 using TriPure Isolation Reagent from Sigma-Aldrich.

Manufacturer protocol

Download the product protocol from Sigma-Aldrich for TriPure Isolation Reagent below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized KG-1 using TriPure Isolation Reagent from Sigma-Aldrich. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.