TRI Reagent® Sigma

Protocol tips

Upstream tips	Protocol tips	Downstream tips
- 1-Bromo-3-chloropropane is less toxic than chloroform and its use for phase separation decreases the possibility of contaminating RNA with DNA. - The chloroform used for phase separation should not contain isoamyl alcohol or other additives.

Upstream tips
- 1-Bromo-3-chloropropane is less toxic than chloroform and its use for phase separation decreases the possibility of contaminating RNA with DNA. - The chloroform used for phase separation should not contain isoamyl alcohol or other additives.

Publication protocol

Total RNA was extracted from NK‐92MI‐scFv, NK‐92MI‐mock or parental NK‐92MI cells using the TRI Reagent (Sigma) according to the manufacturer's protocol. RNA was then treated with DNaseI (Roche Diagnostics), purified through a RNeasy column (Qiagen) and electrophoresed to determine the integrity of the extracted RNA. Complementary DNA (cDNA) was synthesized from 2 μg of total RNA using random hexamers (Proligo) and SuperScript III Reverse Transcriptase (Invitrogen). RT‐PCR was performed using primers specific for scFv (4B3) sequence: forward 5′‐ AGCCTGACAAGCGAGGATAGC‐3′, reverse 5′‐ GTCTGGGTCATCACCACATCG‐3′. The primers for GAPDH: forward 5′‐ GGAGTCCACTGGCGTCTTC‐3′, reverse 5′‐ GCTGATGATCTTGAGGCTGTTG‐3′. The RT‐PCR conditions were as follows: 10 min at 94 °C, denaturation at 94 °C for 20 s, annealing at 59 °C for 30 s, and extension at 72 °C for 60 s.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized NK-92MI using TRI Reagent® Sigma from Sigma-Aldrich.

Manufacturer protocol

Download the product protocol from Sigma-Aldrich for TRI Reagent® Sigma below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized NK-92MI using TRI Reagent® Sigma from Sigma-Aldrich. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.