RNeasy Mini Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	- To yield high RNA, give the column an extra wash with both RW1 and RPE buffers (3 total washes with each buffer).	- Include DNAse treatment for 15-20min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C. - Use water to elute the RNA that is warmed to ~60`C.

Protocol tips
- To yield high RNA, give the column an extra wash with both RW1 and RPE buffers (3 total washes with each buffer).
Downstream tips
- Include DNAse treatment for 15-20min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C. - Use water to elute the RNA that is warmed to ~60`C.

Publication protocol

To detect EGFR mRNA expression in glioma cells, RNA was extracted from the cell lines with RNeasy Mini Kit (Qiagen, Hilden, Germany) and quantified with NanoDrop (Thermo Fisher, Wilmington, DE). Reverse transcripts were produced using M-MLV reverse transcriptase (Invitrogen, Grand Island, NY), and PCR was conducted with GoTaq® Flexi DNA Polymerase (Promega, Madison, WI). The forward primer is TGACTCCGTCCAGTATTGATCG, and the reverse primer is GCCCTTCGCACTTCTTACACTT. The PCR reaction parameters are 95 °C 5 min, 35 cycles at 95 °C 40 s, 55 °C 40 s, 72 °C 1 min, and final extension at 72 °C for 10 min.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized U-251 using RNeasy Mini Kit from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for RNeasy Mini Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized U-251 using RNeasy Mini Kit from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.