TRIzol Reagent

RNA isolation / purification Cells - immortalized LN15

Experiment
RNA isolation / purification Cells - immortalized LN15
Product
TRIzol Reagent from Thermo Fisher Scientific
Manufacturer
Thermo Fisher Scientific

Protocol tips

Protocol tips
- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Publication protocol

Total RNA was extracted with Trizol (Invitrogen) as recommended in the manufacturer's manual. Briefly, 0.5–1 × 106 cells were lyzed 1 ml Trizol. Extracted RNA was treated with 10 U DNase I for 30 min at 37°C and subsequently purified with phenolcholoroform (Ambion). Total RNA (1 μg) was reversed transcribed with MLVV (Epicentre). MiRNAs and mRNA detection was carried out with TaqMan miRNA Assay Kits (Applied Biosystems) and SYBR Green master mix (Applied Biosystems), respectively. The expression of miRNAs and mRNA was normalized to the U1 RNA. PAI F: CTCTCTCTGCCCTCACCAAC R: GTGGAGAGGCTCTTGGTCTG; U1 F: CCATGATCACGAAGGTGGTT R: ATCCGGAGTGCAATGGATAA.

Full paper   Login or join for free to view the full paper.

Reviews

TRIzol Reagent from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

4 years ago

Author: Switzerland

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

I am having trouble using the QiageN RNAeasy mini kit for CD34+ cells. Any tips?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized LN15 using TRIzol Reagent from Thermo Fisher Scientific.

View full paper   Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for TRIzol Reagent below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized LN15 using TRIzol Reagent from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms