RNeasy Plus Mini Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
		- Include DNAse treatment for 15-20min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C. - Use water to elute the RNA that is warmed to ~60`C.

Downstream tips
- Include DNAse treatment for 15-20min. - Ensure EtOH is completely evaporated off of the column prior to elution. Adjust time from 1min to 5 min at 60`C. - Use water to elute the RNA that is warmed to ~60`C.

Publication protocol

RNA was isolated using a Qiagen RNeasy plus mini kit (Qiagen, Hilden, Germany). Subsequently, cDNA was synthesized with random hexamer primers using the Fermentas Revertaid cDNA synthesis kit (Fermentas, Leon‐Rot, Germany). qRT‐PCR was executed with 10 ng cDNA for ICAM‐1 or VE‐cadherin expression (Taqman gene expression assay Hs00164932_m1 or Hs00174344_m1, respectively; Applied Biosystems, Carlsbad, CA) and for GAPDH expression [primers: Fw 5′‐CCACATCGCTCAGACACCAT‐3′, Rev 5′‐GCGCCCAATACGACCAAAT‐3′ and probe: CGTTGACTC CGACCTTCACCTTCCC (Eurogentec, Maastricht, The Netherlands)] using an ABI ViiA7 real‐time PCR system (Applied Biosystems). For ICAM‐4 expression detection, qRT‐PCR was performed using AbsoluteQPCR SYBRGreen‐ROXMix (Abgene, Surrey, United Kingdom) and ICAM‐4 primers: 5′‐CGGGTTGGGTGTCTTACCAG‐3′ (Fw) and 5′‐GACCGGA GGCTCCAAAATCA‐3′ (Rev). Results are shown as relative expression compared to GAPDH levels using the comparative Ct values method.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Cells - immortalized Caov-3 using RNeasy Plus Mini Kit from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for RNeasy Plus Mini Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Cells - immortalized Caov-3 using RNeasy Plus Mini Kit from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.