EZ-RNA Total RNA Isolation Kit

RNA isolation / purification Tissue - Human Brain

Experiment

RNA isolation / purification Tissue - Human Brain

Product

EZ-RNA Total RNA Isolation Kit from Biological Industries

Manufacturer

Biological Industries

Buy product Write review

Tips Publication protocol Reviews Discussion Papers Manufacturer protocol Videos

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	- The following might help to increase RNA yield - Heat the DEPC Water to 70°C before adding to the column. - Increase the incubation time to 5 minutes. - Increase the elution volume. - Repeat the elution step with fresh DEPC Water (this may increase the yield, but decrease the concentration). - Repeat the elution step using the eluate from the first elution (this may increase yield while maintaining elution volume).

Protocol tips
- The following might help to increase RNA yield - Heat the DEPC Water to 70°C before adding to the column. - Increase the incubation time to 5 minutes. - Increase the elution volume. - Repeat the elution step with fresh DEPC Water (this may increase the yield, but decrease the concentration). - Repeat the elution step using the eluate from the first elution (this may increase yield while maintaining elution volume).

Protocol tips

- The following might help to increase RNA yield

- Heat the DEPC Water to 70°C before adding to the column.

- Increase the incubation time to 5 minutes.

- Increase the elution volume.

- Repeat the elution step with fresh DEPC Water (this may increase the yield, but decrease the concentration).

- Repeat the elution step using the eluate from the first elution (this may increase yield while maintaining elution volume).

Publication protocol

Total RNA was isolated from lymphoblastoid cells using the EZ-RNA Total RNA Isolation Kit (Biological Industries). Total human RNA of different tissues was purchased from Clontech. Reverse transcription was done using Reverse-iT 1st Strand Synthesis kit (ABgene). The quality of the resulting cDNA has been tested by the amplification of tubulin chaperone E gene with the primers: forward-5′AAAACGTCCATGTTCCCATC3′; reverse-5′CCCCAGACACGATAAGCAGT3′.

Full paper Login or join for free to view the full paper.

Reviews

EZ-RNA Total RNA Isolation Kit from Biological Industries has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

4 years ago

Author: Paul G. Macon United States

RNA isolation from tissue

How do I extract RNA from animal tissue without using liquid nitrogen? I tried the RNA extraction by using the TRIzol reagent and I homogenize the tissue using polytron homogenizer at room temperature for 30secs is this correct?

Comment View 2 comments

Discussion

4 years ago

Author: Aaron Stege Netherlands

Problem in phase separation after using serum/plasma kit

I used a serum/plasma kit for my serum samples. After the phase separation the samples should have 3 phases: a colourless aqueous phase, a white interphase and a red organic phase. However, in some of my samples there was no aqueous phase unless I wait for an extended period of time. How can I circumvent this problem?

Comment View 2 comments

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Tissue - Human Brain using EZ-RNA Total RNA Isolation Kit from Biological Industries.

Paper title

Human Calmodulin Methyltransferase: Expression, Activity on Calmodulin, and Hsp90 Dependence

Full paper

Manufacturer protocol

Download the product protocol from Biological Industries for EZ-RNA Total RNA Isolation Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Tissue - Human Brain using EZ-RNA Total RNA Isolation Kit from Biological Industries. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

Outsource experiment