TRIzol Reagent

RNA isolation / purification Tissue - Mouse Iris

Experiment
RNA isolation / purification Tissue - Mouse Iris
Product
TRIzol Reagent from Thermo Fisher Scientific
Manufacturer
Thermo Fisher Scientific

Protocol tips

Protocol tips
- For low 260/230 readings the best approach is to try washing sample (precipitation) with ethanol to desalt it.

Publication protocol

Total RNA was isolated from dissected eyes or lenses with Trizol® Reagent (Invitrogen), contaminating DNA was eliminated by DNAse I digestion and RNA was repurified with RNeasy Micro kit (Qiagen). Random-primed cDNA was generated from 500 ng of total RNA using SuperScript VILO cDNA Synthesis kit (Invitrogen). Primers 5′ GTGAAGGAACCTTACTTCTGTGGTG 3′, and 5′ GTCCTTGGGGTCTTCTACCTTTCTC 3′, derived from the SV40 small T intron, were used for RT-PCR detection of transgenic CLEF mRNA. Total RNA was isolated from two lenses of one E16.5 embryo, or newborn with Trizol® Reagent. At least three different E16.5 embryos were used for total RNA isolation. Random-primed cDNA was generated from 200 ng of total RNA using SuperScript VILO cDNA Synthesis kit (Invitrogen) and two independent synthesis of cDNA were performed from one total RNA sample.

Full paper   Login or join for free to view the full paper.

Reviews

TRIzol Reagent from Thermo Fisher Scientific has not yet been reviewed for this experiment

We'd love it if you would be the first to write a review!

Discussion

Discussion

5 years ago

Author: Paul G. Macon United States

RNA isolation from tissue

How do I extract RNA from animal tissue without using liquid nitrogen? I tried the RNA extraction by using the TRIzol reagent and I homogenize the tissue using polytron homogenizer at room temperature for 30secs is this correct?

Discussion

5 years ago

Author: Aaron Stege Netherlands

Problem in phase separation after using serum/plasma kit

I used a serum/plasma kit for my serum samples. After the phase separation the samples should have 3 phases: a colourless aqueous phase, a white interphase and a red organic phase. However, in some of my samples there was no aqueous phase unless I wait for an extended period of time. How can I circumvent this problem?

Share your thoughts or question with experts in your field by adding a discussion!

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing RNA isolation / purification Tissue - Mouse Iris using TRIzol Reagent from Thermo Fisher Scientific.

Paper title
Ectopic Activation of Wnt/β-Catenin Signaling in Lens Fiber Cells Results in Cataract Formation and Aberrant Fiber Cell Differentiation
Full paper
Login or join for free to view the full paper.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for TRIzol Reagent below.

Download PDF Download manufacturer protocol

Videos

Check out videos that might be relevant for performing RNA isolation / purification Tissue - Mouse Iris using TRIzol Reagent from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.

We haven't found any additional videos for this experiment / product combination yet.

Outsource your experiment

Fill out your contact details and receive price quotes in your Inbox

  Outsource experiment
Become shareholder Discussions About us Contact Privacy Terms