Hs_HES6_1 FlexiTube siRNA.

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Hs_HES6_1:TTGGAGTTAGTTACCCTTGAA Final concentration of 15 nM. Incubate the FuGENE 6 Transfection Reagent/medium mixture for 5 minutes at room temperature Incubate transfection mixture for 15 min at room temperature and add to cells and shake for 10-30 seconds. Incubate cells for 24-48 h.

Protocol tips
Hs_HES6_1:TTGGAGTTAGTTACCCTTGAA Final concentration of 15 nM. Incubate the FuGENE 6 Transfection Reagent/medium mixture for 5 minutes at room temperature Incubate transfection mixture for 15 min at room temperature and add to cells and shake for 10-30 seconds. Incubate cells for 24-48 h.

Publication protocol

Cell lines A172 and U87MG were obtained from ECACC (Salisbury, UK), LN405 from the DSMZ (Braunschweig, Germany) and SVG p12 from ATCC (Manassas, VA, USA). Cells were cultured in medium conditions recommended by the providers for less than 4 months before use in these experiments. Sequences for three siRNAs for HES6 and a control siRNA for PLK1 are described in supplementary materials. All siRNAs were purchased from Qiagen (Hilden, Germany). Additional control siRNAs were AllStars Hs Cell Death Control siRNA (Qiagen) and Negative Control siRNA (Qiagen). The siRNAs were used at a final concentration of 15 nM each, or as a pool of three siRNAs (denoted as siHES6) 10 nM each, thus giving a final concentration of 30 nM. LN405 cells were used for creating stable cell lines by transfecting pEYFP-C1-mock and pEYFP-C1-HES6 with Fugene6 (Roche Applied Science, Indianapolis, IN, USA) and selecting the positive cells with 600 μg/ml and maintained with 400 μg/ml of G418 (Sigma-Aldrich, St Louis, MO, USA).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Human - A172 HES6 using Hs_HES6_1 FlexiTube siRNA. from Qiagen.

Manufacturer protocol

Download the product protocol from Qiagen for Hs_HES6_1 FlexiTube siRNA. below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Human - A172 HES6 using Hs_HES6_1 FlexiTube siRNA. from Qiagen. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.