Protocol tips |
---|
Plk1-Si1:AACCAGUGGUUCGAGAGACAG Add diluted siRNA to diluted Lipofectamine Reagent Incubate for 5 min at RT and add to cells. Incubate cells for 1–3 days at 37°C. |
ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon has not yet been reviewed for this experiment
We'd love it if you would be the first to write a review!
Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Human - H1299 PLK-1 using ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon.
Download the product protocol from Dharmacon for ON-TARGETplus Human PLK1 (5347) siRNA - Individual below.
Download manufacturer protocolCheck out videos that might be relevant for performing siRNA / miRNA gene silencing Human - H1299 PLK-1 using ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.
We haven't found any additional videos for this experiment / product combination yet.
Fill out your contact details and receive price quotes in your Inbox
Outsource experiment