Accell Human CD44 (960) siRNA - SMARTpool

Protocol tips

Upstream tips	Protocol tips	Downstream tips
Seed 2.5 × 10^4 cells cm−2	siRNA sequence: 5′-GGCGCAGAUCGAUUUGAAU-3' Final siRNA concentration of 1 μM. Add diluted siRNA to diluted Lipofectamine® RNAiMAX Reagent (1:1 ratio). Incubate for 5 minutes at room temperature and add to cells. Replace medium after 24h and re-incubate cells for 1 day at 37°C.

Upstream tips
Seed 2.5 × 10^4 cells cm−2
Protocol tips
siRNA sequence: 5′-GGCGCAGAUCGAUUUGAAU-3' Final siRNA concentration of 1 μM. Add diluted siRNA to diluted Lipofectamine® RNAiMAX Reagent (1:1 ratio). Incubate for 5 minutes at room temperature and add to cells. Replace medium after 24h and re-incubate cells for 1 day at 37°C.

Publication protocol

The siRNA molecules used were a 19 + 2 format, synthesised with two 3′ deoxythymidines (dT) overhangs. An unmodified non-self-delivery (non-sd-) lamin A/C siRNA (Lamin A/C non-sd-siRNA; sequence: 5′- CUGGACUUCCAGAAGAACA) targeting human lamin A/C mRNA was designed and synthesised by Eurofins MWG Operons (Ebersberg, Germany). A nonspecific unmodified green fluorescent protein (GFP) siRNA (Control non-sd-siRNA; sequence: 5′- GGCUACGUCCAGGAGCGCACC) targeting the GFP mRNA not present in the human keratinocytes model was used as a control.

Accell modified self-delivery (sd-) CD44 siRNA (Accell CD44 sd-siRNA) and non-Accell modified non-sd-siRNA (siSTABLE CD44 non-sd-siRNA) targeting human CD44 mRNA (both siRNA sequence: 5′-GGCGCAGAUCGAUUUGAAU) [33] were designed and synthesised by Dharmacon Products, Thermo Fisher Scientific (Lafayette, CO, USA). A nonspecific self-delivery K6a_513a.12 siRNA (Accell control sd-siRNA) targeting a keratin 6a mutation not present in the human keratinocytes model or the mouse skin model was used as control [34].

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Human - HaCaT CD44 using Accell Human CD44 (960) siRNA - SMARTpool from Dharmacon.

Manufacturer protocol

Download the product protocol from Dharmacon for Accell Human CD44 (960) siRNA - SMARTpool below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Human - HaCaT CD44 using Accell Human CD44 (960) siRNA - SMARTpool from Dharmacon. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.