ON-TARGETplus Human PLK1 (5347) siRNA - Individual

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	Plk1-Si1 siRNA-AACCAGUGGUUCGAGAGACAG Add diluted siRNA to diluted Lipofectamine Reagent Incubate for 5 min at RT and add to cells. Incubate cells for 1–3 days at 37°C.

Protocol tips
Plk1-Si1 siRNA-AACCAGUGGUUCGAGAGACAG Add diluted siRNA to diluted Lipofectamine Reagent Incubate for 5 min at RT and add to cells. Incubate cells for 1–3 days at 37°C.

Publication protocol

Plk1 siRNAs were purchased from Dharmacon Research, Inc. (Lafayette, CO): Plk1-Si1 (AACCAGUGGUUCGAGAGACAG) and Plk1 Si1C (AACCAGUUUGGCGAGAGACAG). The selection of these sequences was based on the sequence of the best Plk1 AS oligo isis121969 (GAACCAGUGGUUCGAGAGACA) obtained from ISIS Pharmaceuticals (Carlsbad, CA; data not shown).

Transfection. siRNA was transfected using LipofectAMINE 2000 (LF2000) from Invitrogen (Carlsbad, CA) according to the manufacturer's instructions.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing siRNA / miRNA gene silencing Human - HeLa PLK-1 using ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon.

Manufacturer protocol

Download the product protocol from Dharmacon for ON-TARGETplus Human PLK1 (5347) siRNA - Individual below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing siRNA / miRNA gene silencing Human - HeLa PLK-1 using ON-TARGETplus Human PLK1 (5347) siRNA - Individual from Dharmacon. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.