Purelink PCR Purification Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
The amount of agarose excised from the gel should be as small as possible.	Remove the flow-through by aspiration. Avoid contamination of the collection tube rim.

Upstream tips
The amount of agarose excised from the gel should be as small as possible.
Protocol tips
Remove the flow-through by aspiration. Avoid contamination of the collection tube rim.

Publication protocol

PureLink PCR Purification kit (Invitrogen, Carlsbad, CA, USA) was used to extract DNA from the cysts according to the recommendations of the manufacturer [23]. A fragment of 753 bp (base pairs) from the bg gene was amplified with the primers G7 (5′AAGCCCGACGACCTCACCCGCAGTGC3′) and G759 (5′GAGGCCGCCCTGGATCTTCGAGACGAC-3′) [24] with modifications as previously described [23]. To obtain a fragment of approximately 432 base pairs from the gdh gene, a semi-nested PCR was performed using the following primers: external forward primer GDHeF (5’TCAACGTYAAYCGYGGYTTCCGT3’), internal forward primer GDHiF (5’CAGTACAACTCYGCTCTCGG3’), and reverse primer GDHiR (5’GTTRTCCTTGCACATCTCC3’) [25] with modifications. Each amplification reaction was performed in a final volume of 11 μL, containing buffer 10× (200 mmol/L Tris-HCl pH 8.4, 500 mmol/L KCl, 1.5 mmol/L MgCl2, 1.5 U of Platinum Taq DNA Polymerase (Invitrogen) for the bg marker and 0.5 U for the gdh marker, 200 μmol/L of triphosphate deoxyribonucleotides, 2 pmol of each primer, sterile Milli-Q H2O, and 2 μL of total DNA. The conditions for amplification of the bg marker were: denaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, 65°C for 30 s, 72°C for 60 s and a final extension at 72°C for 7 min, and for the gdh marker were: denaturation at 94°C for 2 min, followed by 35 cycles at 94°C for 45 s, 55°C for 30 s, 72°C for 45 s and a final extension at 72°C for 5 min, in the first and second reactions. The amplified products were visualized in 5.0% polyacrylamide gels, silver stained, and digitally recorded

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing DNA gel extraction / PCR product purification Product size < 15Kb using Purelink PCR Purification Kit from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Purelink PCR Purification Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing DNA gel extraction / PCR product purification Product size < 15Kb using Purelink PCR Purification Kit from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.