Imprint® Chromatin Immunoprecipitation Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
-If any reagent has formed a precipitate, warm at 55 °C until dissolved. Allow to equilibrate to room temperature before use.	-Use 1 µg of antibody per well. -The range of cells that can be used with this kit is 0.2–2.5 x 105/well/ChIP sample. Using more than 0.5 million cells per well will increase the non-specific binding and reduce the yield and specificity of the ChIP reaction. If higher yield of ChIP DNA is desired for downstream applications (e.g. ChIP-Seq., ChIP-chip): a) DNA could be pooled by eluting consecutively (with 50 µl of elution buffer) from multiple individual ChIP reactions.

Upstream tips
-If any reagent has formed a precipitate, warm at 55 °C until dissolved. Allow to equilibrate to room temperature before use.
Protocol tips
-Use 1 µg of antibody per well. -The range of cells that can be used with this kit is 0.2–2.5 x 105/well/ChIP sample. Using more than 0.5 million cells per well will increase the non-specific binding and reduce the yield and specificity of the ChIP reaction. If higher yield of ChIP DNA is desired for downstream applications (e.g. ChIP-Seq., ChIP-chip): a) DNA could be pooled by eluting consecutively (with 50 µl of elution buffer) from multiple individual ChIP reactions.

Publication protocol

To perform ChIP, the imprint ChIP kit was used. After the indicated treatment, CD4+ T cells were fixed wth 1% formaldehyde and digested with micrococcal nuclease to induce optimal genomic DNA fragmentation. The cells were then lysed in lysis buffer. After sonication, immunoprecipitation was performed with the samples with anti-PAR2, or anti-pHDAC1, or IgG. The non-antibody treated chromatin was set aside and used as the input DNA. Protein A sepharose beads were added to precipitate the antibody-protein-DNA complex. Then, the complex was reversibly cross-linked using proteinase K at 65 °C to obtain the IP DNA, which was purified afterward. With the IP DNA, relative abundance of DNA sequence from the GATA3 promoter region was analyzed by qPCR in a qPCR device (LightCycler 480 qPCR instrument; Roche Diagnostics Corporation). The primer sequences used are: Forward, aacctcttaagttgcgtcgc; reverse, caaggagcgtagaggaggag. The enriched DNA after qPCR was represented as % input.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Mouse - CD4+ T using Imprint® Chromatin Immunoprecipitation Kit from Sigma-Aldrich.

Manufacturer protocol

Download the product protocol from Sigma-Aldrich for Imprint® Chromatin Immunoprecipitation Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Mouse - CD4+ T using Imprint® Chromatin Immunoprecipitation Kit from Sigma-Aldrich. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.