Pierce™ Agarose ChIP Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
-If you are unfamiliar with cell type being used, culture an extra dish of cells for determining cell number. Before crosslinking, trypsinize and determine the cell number from the extra dish of cells.	-After incubation, it is essential to open the column cap before plug removal to equalize the pressure within the column. Failure to open the cap before plug removal will result in sample loss.	- If you are preparing chromatin in bulk, unused supernatant may be stored at -80°C for later use.

Upstream tips
-If you are unfamiliar with cell type being used, culture an extra dish of cells for determining cell number. Before crosslinking, trypsinize and determine the cell number from the extra dish of cells.
Protocol tips
-After incubation, it is essential to open the column cap before plug removal to equalize the pressure within the column. Failure to open the cap before plug removal will result in sample loss.
Downstream tips
- If you are preparing chromatin in bulk, unused supernatant may be stored at -80°C for later use.

Publication protocol

Protein/DNA complexes were cross-linked with 1% formaldehyde. Chromatid was isolated and sonicated. Ten percent of the lysate containing digested chromatid was conserved for input. The remaining lysate was diluted and immunoprecipitated with 5μg of rabbit anti-E2F1 (C-20) or rabbit control Igg (Santa Cruz biotechnology) overnight. Elution and DNA recovery were carried out according to recommendations of PIERCE Agarose Chip Kit (Thermo Scientific). Real-time PCR was performed as previously described [28] using primers flanking the E2F-binding site in birc2 promoters (BS1 primer sense: (5’-TGAGGTGACACAGGGTAGGA-3’, antisense: 5’- GGTTTCCCAAAACTCAAACG-3’; BS2 primer sense: 5’- ACTCTTCTGGCCCTTGGACT -3’, antisense: 5’-AAACTTAGCCCTCGGCGTT -3’). For the ChIP-seq analysis, enriched DNA from ChIP and input DNA fragments were end-repaired, extended with an ‘A’ base on the 3′-end, ligated with indexed paired-end adaptors (NEXTflex, Bio Scientific, Saint-Marcel, France) using the Bravo Platform (Agilent), size-selected after 4 cycles of PCR with AMPure XP beads (Beckman Coulter, Villepinte, France) and amplified by PCR for 10 more cycles. Library quality was assessed by a bioanalyzer using a High Sensitivity chip.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - HeLa using Pierce™ Agarose ChIP Kit from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for Pierce™ Agarose ChIP Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Human - HeLa using Pierce™ Agarose ChIP Kit from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.