Protocol tips
Upstream tips |
Protocol tips |
Downstream tips |
|
-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation.
Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody.
-Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target. |
|
Protocol tips |
-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation.
Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody.
-Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target. |
Publication protocol
Chromatin immunoprecipitation (ChIP) assays were performed according to the EZ-CHIP kit (Millipore, Temecula, CA, USA). Anti-Bach1 (1:100, ab49657; Abcam) antibodies were used to precipitate the DNA-protein complexes. The immunoprecipitated DNA was examined by PCR. Primers specific for the AZIN2-sv promoter containing the E-box were 5′-GAGATGAGTGAGCAG-3′(forward) and 5′- CTGCTGGGCTGGCGGGGCGCA GG-3′ (reverse).
Full paper
Login or
join for free to view the full paper.
Reviews
EZ-ChIP™ from Merck Millipore has not yet been reviewed for this experiment
We'd love it if you would be the first to write a review!
Discussion
Start your discussion
Share your thoughts or question with experts in your field
Start a discussion
Papers
Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - HUVEC using EZ-ChIP™ from Merck Millipore.
Videos
Check out videos that might be relevant for performing ChIP Human - HUVEC using EZ-ChIP™ from Merck Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.
We haven't found any additional videos for this experiment / product combination yet.