EZ-ChIP™

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Protocol tips
-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Publication protocol

Chromatin immunoprecipitation (ChIP) assays were performed according to the EZ-CHIP kit (Millipore, Temecula, CA, USA). Anti-Bach1 (1:100, ab49657; Abcam) antibodies were used to precipitate the DNA-protein complexes. The immunoprecipitated DNA was examined by PCR. Primers specific for the AZIN2-sv promoter containing the E-box were 5′-GAGATGAGTGAGCAG-3′(forward) and 5′- CTGCTGGGCTGGCGGGGCGCA GG-3′ (reverse).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - HUVEC using EZ-ChIP™ from Merck Millipore.

Manufacturer protocol

Download the product protocol from Merck Millipore for EZ-ChIP™ below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Human - HUVEC using EZ-ChIP™ from Merck Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.