ChIP Kit (ab500)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
-Optimal conditions to obtain the desired fragment size should be determined prior to the immunoprecipitation (IP) by performing a sonication time course.	-The minimum number of cells to be processed is 3x106 cells for 3 ChIPs. -Sonicating for too long will disrupt nucleosome-DNA interactions therefore the band size should not be smaller than 200 bp. -The amount of antibody can vary but 2-5 µg is a good starting point.

Upstream tips
-Optimal conditions to obtain the desired fragment size should be determined prior to the immunoprecipitation (IP) by performing a sonication time course.
Protocol tips
-The minimum number of cells to be processed is 3x106 cells for 3 ChIPs. -Sonicating for too long will disrupt nucleosome-DNA interactions therefore the band size should not be smaller than 200 bp. -The amount of antibody can vary but 2-5 µg is a good starting point.

Publication protocol

To examine potential STAT1-CXCL10 promoter interactions we initially performed in silico search for putative STAT1 binding sites within the promoter region of human CXCL10 using the MatInspector software (Genomatix, Munich, Germany). We employed an anti-STAT1 antibody (#9172), a normal rabbit IgG (#2729) (Cell Signaling Technology MA, USA) as a control and a commercially available chromatin immmunoprecipitation (ChIP) assay kit ab500 (Abcam, UK). The ChIP assay was performed according to the manufacturer’s instructions. Briefly, Huh7 cells under the different treatment conditions of interest were cross-linked with 1% formaldehyde. Cells were lysed using the supplied buffer (Abcam, UK). Cell lysates were subsequently sonicated, resulting in DNA fragments of 200–1000 bp. Protein-bound, immunoprecipitated DNA was reverse cross-linked and then purified using supplied buffer. DNA extracts were amplified by PCR using HotStarTaq (QIAGEN, Germany) for 35 cycles. The following primers 5- GTTAGAATGGATTGCAACCTTTG -3 (forward) and 5- CTCTGCTGTAGGCTCAGAATA -3 (reverse) were employed to amplify the STAT1 predicted binding sites.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - HUH-7 using ChIP Kit (ab500) from Abcam.

Manufacturer protocol

Download the product protocol from Abcam for ChIP Kit (ab500) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Human - HUH-7 using ChIP Kit (ab500) from Abcam. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.