EZ-Magna ChIP™ A/G Chromatin Immunoprecipitation Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Protocol tips
-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Publication protocol

ChIP assay was performed with the EZ‐Magna ChIP kit (Millipore) according to the manufacturer's instructions. For each ChIP assay, 2 μg of antibodies were used: EZH2 (Cell Signaling Technology), H3K27me3 (Millipore) and H3 (Abcam). The percentage of the bound DNA was quantified against the original DNA input by qRT‐PCR analysis. Primer sequences used are as follows: CDH1 (5′‐TAGAGGGTCACCGCGTCTAT‐3′ and 5′‐TCACAGGTGCTTTGCAGTTC‐3′).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - RCC using EZ-Magna ChIP™ A/G Chromatin Immunoprecipitation Kit from Merck Millipore.

Manufacturer protocol

Download the product protocol from Merck Millipore for EZ-Magna ChIP™ A/G Chromatin Immunoprecipitation Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Human - RCC using EZ-Magna ChIP™ A/G Chromatin Immunoprecipitation Kit from Merck Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.