SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) #9003

Protocol tips

Upstream tips	Protocol tips	Downstream tips
-Once in solution, store 1M DTT at -20°C.	-For optimal ChIP results, use approximately 4 X 106 cells for each immunoprecipitation to be performed. -For optimal ChIP results, it is highly critical that the chromatin is of appropriate size and concentration. -For optimal ChIP results, use approximately 5 to 10 µg of digested, cross-linked chromatin per immunoprecipitation.

Upstream tips
-Once in solution, store 1M DTT at -20°C.
Protocol tips
-For optimal ChIP results, use approximately 4 X 106 cells for each immunoprecipitation to be performed. -For optimal ChIP results, it is highly critical that the chromatin is of appropriate size and concentration. -For optimal ChIP results, use approximately 5 to 10 µg of digested, cross-linked chromatin per immunoprecipitation.

Publication protocol

ChIP analysis was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Agarose Beads) from Cell Signaling Technology (Beverly, MA, USA) as per manufacturer's instructions. Briefly, 1×107 airway smooth muscle cells were fixed in formaldehyde to final concentration of 1% for 10 minutes and then stopped by adding glycine. Cross-linked chromatin was digested using Micrococcal nuclease at 37°C for 20 minutes followed by a brief sonication to generate 200–500 bp DNA fragments. Sheared chromatin was incubated with anti-Sp1 (PEP2) X TransCruz reagent (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or normal rabbit antibody (IgG) as negative control and precipitated using Protein G-agarose beads. Immunoprecipitated chromatin complexes were washed sequentially in Low- and High- salt wash buffers and protein-DNA cross-links were reversed in presence of Proteinase K at 65°C for 4 hours. DNA fragments were purified using the spin columns supplied in the kit as per recommendations. 2 µl of DNA from each sample was used as a template for PCR amplification. PCR was performed with denaturation at 94°C for 30 seconds, annealing at 59°C for 30 seconds and extension at 72°C for 30 seconds for 40 cycles followed by 10 minutes at 72°C using primers designed to amplify the region encompassing putative Sp1 binding sites on WNT-5A promoter A Fwd 5′- ACAGGATCGCGTGGAAATCT -3′and Rev 5′- GAAGCTGCCCACCTCCTC -3′.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - ASM using SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) #9003 from Cell Signaling Technology.

Manufacturer protocol

Download the product protocol from Cell Signaling Technology for SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) #9003 below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Human - ASM using SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) #9003 from Cell Signaling Technology. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.