ChIP-IT® Express Chromatin Immunoprecipitation Kits

Protocol tips

Upstream tips	Protocol tips	Downstream tips
-Do not re-freeze the Protein G magnetic beads, the beads should be stored at 4C.	-Always use ChIP validated antibody. -Optimal use of 1-3 ug of antibody.	-The diluted Proteinase K stop solution can not be stored.

Upstream tips
-Do not re-freeze the Protein G magnetic beads, the beads should be stored at 4C.
Protocol tips
-Always use ChIP validated antibody. -Optimal use of 1-3 ug of antibody.
Downstream tips
-The diluted Proteinase K stop solution can not be stored.

Publication protocol

Human peripheral white blood and colorectal cancer cells were used for ChIP assay with a ChIP‐IT™ Express Magnetic Assay kit and ChIP‐IT™ Control qPCR kit (Active Motif, Carlsbad, CA, USA) as described previously.21 Briefly, the following antibodies were used for the immunoprecipitation reaction: Sp1, NF1, positive control RNA poly (Active Motif, Carlsbad, CA, USA) or negative control IgG (Active Motif, Carlsbad, CA, USA). The precipitated genomic DNA was analyzed by quantitative RT‐PCR with the following DR4 promoter primers including the rs13278062 polymorphism: 5′‐CCTCAGCCTTTCTGTGACCC‐3′ (forward) and 5′‐AAATCGCTTGAACCTGGGAG‐3′ (reverse).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - SW480 using ChIP-IT® Express Chromatin Immunoprecipitation Kits from Active Motif.

Manufacturer protocol

Download the product protocol from Active Motif for ChIP-IT® Express Chromatin Immunoprecipitation Kits below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Human - SW480 using ChIP-IT® Express Chromatin Immunoprecipitation Kits from Active Motif. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.