Chromatin Immunoprecipitation (ChIP) Assay Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Protocol tips
-Just because an antibody works well in a Western blot does not always indicate it will perform well in chromatin immunoprecipitation. Unlike a Western blot that detects proteins that have been denatured, a ChIP antibody must recognize the target protein in its native state. Use ChIP-validated antibody. -Use 2-10 μg of your ChIP antibody depending on the abundance of your protein target.

Publication protocol

Nuclei for the ChIP assays were sonicated in shearing buffer, and the shearing effectiveness was confirmed by electrophoresis in ethidium bromide-stained agarose gels. The samples were then processed for immunoprecipitation using a kit (EZ-ChIP™ Chromatin Immunoprecipitation Kit, Millipore) and antibodies to KLF8 (Santa) according to the manufacturer’s instructions. After precipitation, the cross-linking was reversed, and PCR was carried out using 1 μL of each sample (input DNA dilution 1:10; immunoprecipitated fractions were undiluted) in PCR buffer (Qiagen, Valencia, CA) containing dNTPs (Invitrogen) and TAQ DNA polymerase (Qiagen) with the primers. Three sets of primers were used to amplify three “CACCC” sites of the VEGFA promoter region. ChIP assay real-time PCR results indicated that KLF8 binds to the “CACCC” site 637 nucleotides upstream of the VEGFA promoter region. Therefore, we used the 1386-5′GCTGTTTGGGAGGTCAGAAATAGG 3′-1409 and 1545-5′ ACGCTGCTCGCTCCATTCAC 3′-1526 primers; in addition, we used normal rabbit IgG as a negative control. pcDNA3.1-transfected SMMC7721 cells were used as a control group.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Human - SMMC-7721 using Chromatin Immunoprecipitation (ChIP) Assay Kit from Merck Millipore.

Manufacturer protocol

Download the product protocol from Merck Millipore for Chromatin Immunoprecipitation (ChIP) Assay Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Human - SMMC-7721 using Chromatin Immunoprecipitation (ChIP) Assay Kit from Merck Millipore. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.