EpiQuik Chromatin Immunoprecipitation (ChIP) Kit

Protocol tips

Upstream tips	Protocol tips	Downstream tips
-Ensure that all buffers are in clear solution. Shake or vortex if these buffers precipitate.	-When processing spin columns, always cap spin columns before placing them in the microcentrifuge. -The conditions of crosslinked DNA shearing can be optimized based on cells and sonicator equipment. If desired, remove 5 µl of sonicated cell lysate for agarose gel analysis. The length of sheared DNA should be between 200-1000 bp.

Upstream tips
-Ensure that all buffers are in clear solution. Shake or vortex if these buffers precipitate.
Protocol tips
-When processing spin columns, always cap spin columns before placing them in the microcentrifuge. -The conditions of crosslinked DNA shearing can be optimized based on cells and sonicator equipment. If desired, remove 5 µl of sonicated cell lysate for agarose gel analysis. The length of sheared DNA should be between 200-1000 bp.

Publication protocol

ChIP was performed using a chromatin immunoprecipitation kit (Epigentek, Farmingdale, NY, US). In brief, rat colon crypts and Caco-2/BBe cells were cross-linked using 1% formaldehyde and terminated by incubation with 0.125 mol/L glycine for 5 min. The cell lysate was incubated for 10 min at 4 °C and the crude nuclear extract was collected by centrifugation at 600 g for 5 min at 4 °C. The DNA was sonicated to random fragments between 200 and 500 bps. The chromatin was subjected to immunoprecipitation using the following antibodies: NR3C1 (#3660; Cell Signaling Technology, Danvers, MA, US), HES1 (#sc-1004; Santa Cruz Biotechnology, Dallas, TX, US). Normal rabbit IgG was used as a control. DNA was eluted in elution buffer and used for PCR amplification. Primers for rat CLDN1 promoter: forward-GGACCCTTGTGGGGATTTG, reverse- CCAGGAGGTTAGCGCTGATAC and human CLDN1 promoter: forward-GATAATTGGAGTGAATGAATGAAAAG, reverse-GTTTCAGGGCGGCTCAC are bought from Life Technologies (Grand Island, NY, US).

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Rat - Colon using EpiQuik Chromatin Immunoprecipitation (ChIP) Kit from Epigentek.

Manufacturer protocol

Download the product protocol from Epigentek for EpiQuik Chromatin Immunoprecipitation (ChIP) Kit below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Rat - Colon using EpiQuik Chromatin Immunoprecipitation (ChIP) Kit from Epigentek. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.