STAT5 beta Monoclonal Antibody (ST5b-10G1)

Protocol tips

Upstream tips	Protocol tips	Downstream tips
	-Tested Dilution 5 µg/mL

Protocol tips
-Tested Dilution 5 µg/mL

Publication protocol

ChIP assays were performed as previously described (9) with the following changes. 0.37% formaldehyde was used for cross-linking, and sonication was performed using a Fisher sonic dismembranator, model 500, with five bursts of 15 s at a setting of 10%. 10 μg of tRNA and 10 μg of bovine serum albumin were included when the protein A/G beads were added to the immunoprecipitation. For semiquantitative PCR, the primers were as follows: human NCAM2 STAT5 binding region, ACACATCCTTCATACCAGGAAA and TGGCCACCTATTGGTTTCTATC; human NCAM2 negative control region, CTGCACATGATCCATCTTCAAT and CCAGCAATAACTAGGGCATCA. Quantitative real time PCR was performed using the following primers: human NCAM2 STAT5 binding region, ACTTGCATGGGTCACAACAC and CAGGCATGGGGTTGTCTTAC. Data from three replicates were normalized to input and expressed relative to nonspecific IgG. Each assay was performed at least twice.

Full paper   Login or join for free to view the full paper.

Reviews

Discussion

Papers

Check out relevant papers found by Labettor's AI that are relevant for performing ChIP Anti-bodies Stat5b using STAT5 beta Monoclonal Antibody (ST5b-10G1) from Thermo Fisher Scientific.

Manufacturer protocol

Download the product protocol from Thermo Fisher Scientific for STAT5 beta Monoclonal Antibody (ST5b-10G1) below.

Download manufacturer protocol

Videos

Check out videos that might be relevant for performing ChIP Anti-bodies Stat5b using STAT5 beta Monoclonal Antibody (ST5b-10G1) from Thermo Fisher Scientific. Please note that these videos are representative and steps or experiment specific processes must be kept in mind to expect desired results.